Incidental Mutation 'R4042:Otol1'
ID315765
Institutional Source Beutler Lab
Gene Symbol Otol1
Ensembl Gene ENSMUSG00000027788
Gene Nameotolin 1
SynonymsGm414, LOC229389
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location70007613-70028708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70027779 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 368 (D368G)
Ref Sequence ENSEMBL: ENSMUSP00000057607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053013]
Predicted Effect probably damaging
Transcript: ENSMUST00000053013
AA Change: D368G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057607
Gene: ENSMUSG00000027788
AA Change: D368G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Collagen 116 175 8.8e-11 PFAM
internal_repeat_2 183 229 1.02e-7 PROSPERO
Pfam:Collagen 232 302 2.4e-9 PFAM
low complexity region 328 340 N/A INTRINSIC
C1Q 341 475 9.83e-51 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Otol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Otol1 APN 3 70027724 missense probably damaging 1.00
IGL01664:Otol1 APN 3 70027797 missense probably benign 0.01
IGL02205:Otol1 APN 3 70018596 missense probably benign
IGL02445:Otol1 APN 3 70028034 missense probably damaging 1.00
IGL02674:Otol1 APN 3 70018744 missense probably benign 0.01
IGL03376:Otol1 APN 3 70027512 missense probably damaging 0.96
R0094:Otol1 UTSW 3 70018683 missense probably benign 0.03
R0492:Otol1 UTSW 3 70027784 missense probably damaging 0.99
R0504:Otol1 UTSW 3 70027604 missense probably damaging 1.00
R1932:Otol1 UTSW 3 70028104 missense probably benign 0.01
R2049:Otol1 UTSW 3 70018836 missense probably benign 0.06
R2321:Otol1 UTSW 3 70018525 nonsense probably null
R4043:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4044:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4092:Otol1 UTSW 3 70027785 missense probably damaging 0.99
R4433:Otol1 UTSW 3 70018548 missense probably benign 0.02
R4993:Otol1 UTSW 3 70018878 missense probably benign 0.07
R6921:Otol1 UTSW 3 70028100 missense possibly damaging 0.89
R6983:Otol1 UTSW 3 70028041 missense probably damaging 1.00
R7095:Otol1 UTSW 3 70018694 missense probably benign 0.00
R7619:Otol1 UTSW 3 70027869 missense probably damaging 1.00
RF019:Otol1 UTSW 3 70018600 missense probably benign 0.00
X0062:Otol1 UTSW 3 70027640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCGATTCTGGTCCTAAAGG -3'
(R):5'- AGCGTCTCTCTGGATTTGAAC -3'

Sequencing Primer
(F):5'- GAGATAGGTTCTCCTGGTTTCACC -3'
(R):5'- AACTGCTTCCTGTTGCGG -3'
Posted On2015-05-15