Incidental Mutation 'R4042:Ush1c'
ID315771
Institutional Source Beutler Lab
Gene Symbol Ush1c
Ensembl Gene ENSMUSG00000030838
Gene NameUSH1 protein network component harmonin
Synonymsharmonin, 2010016F01Rik
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46195350-46238503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46221528 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 276 (E276G)
Ref Sequence ENSEMBL: ENSMUSP00000135734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000176371] [ENSMUST00000177212] [ENSMUST00000222454]
Predicted Effect probably benign
Transcript: ENSMUST00000009667
AA Change: E295G

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838
AA Change: E295G

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
low complexity region 899 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078680
AA Change: E295G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838
AA Change: E295G

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
PDZ 458 537 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143155
AA Change: E295G

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838
AA Change: E295G

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148527
Predicted Effect probably benign
Transcript: ENSMUST00000154292
AA Change: E295G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838
AA Change: E295G

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176371
AA Change: E264G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838
AA Change: E264G

DomainStartEndE-ValueType
PDZ 65 137 3.06e-19 SMART
low complexity region 159 172 N/A INTRINSIC
PDZ 189 261 5.62e-18 SMART
coiled coil region 270 345 N/A INTRINSIC
PDZ 427 506 1.13e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177212
AA Change: E276G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838
AA Change: E276G

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 291 6.13e-10 SMART
low complexity region 313 325 N/A INTRINSIC
low complexity region 339 357 N/A INTRINSIC
PDZ 439 518 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222454
AA Change: E295G

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.3401 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations at this locus affect hearing and result in movement anomalies generally associated with vestibular mutants, such as head tossing and circling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Ush1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ush1c APN 7 46196770 missense probably benign 0.00
IGL01074:Ush1c APN 7 46225250 splice site probably benign
IGL01099:Ush1c APN 7 46205262 missense probably damaging 0.99
IGL01107:Ush1c APN 7 46209901 missense probably damaging 1.00
IGL01446:Ush1c APN 7 46208956 missense possibly damaging 0.86
IGL02267:Ush1c APN 7 46209298 missense possibly damaging 0.92
IGL02307:Ush1c APN 7 46197188 splice site probably benign
IGL02448:Ush1c APN 7 46209137 missense possibly damaging 0.51
IGL02485:Ush1c APN 7 46229250 missense probably damaging 0.99
IGL02896:Ush1c APN 7 46198415 missense probably benign 0.00
IGL03031:Ush1c APN 7 46224937 splice site probably benign
R0085:Ush1c UTSW 7 46225555 missense probably benign 0.09
R0328:Ush1c UTSW 7 46225448 splice site probably benign
R0574:Ush1c UTSW 7 46196804 missense possibly damaging 0.68
R0600:Ush1c UTSW 7 46224908 missense probably benign 0.00
R1187:Ush1c UTSW 7 46208914 missense probably benign 0.01
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1716:Ush1c UTSW 7 46195728 missense probably benign 0.18
R1727:Ush1c UTSW 7 46209231 missense probably damaging 1.00
R1822:Ush1c UTSW 7 46209901 missense probably damaging 1.00
R1864:Ush1c UTSW 7 46219392 nonsense probably null
R2000:Ush1c UTSW 7 46221433 missense probably damaging 0.99
R2063:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2068:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2944:Ush1c UTSW 7 46200982 missense probably damaging 1.00
R4043:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4108:Ush1c UTSW 7 46198445 missense probably damaging 1.00
R4823:Ush1c UTSW 7 46195733 missense probably benign 0.00
R4862:Ush1c UTSW 7 46229240 missense probably damaging 1.00
R5534:Ush1c UTSW 7 46221423 missense probably damaging 1.00
R5922:Ush1c UTSW 7 46204128 critical splice donor site probably null
R6249:Ush1c UTSW 7 46214959 missense probably damaging 1.00
R6475:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R6485:Ush1c UTSW 7 46209110 missense probably benign
R6667:Ush1c UTSW 7 46225624 missense probably damaging 1.00
R7177:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R7419:Ush1c UTSW 7 46229255 missense probably damaging 1.00
R7424:Ush1c UTSW 7 46225555 missense probably benign 0.09
R7811:Ush1c UTSW 7 46205286 nonsense probably null
R7862:Ush1c UTSW 7 46221424 missense probably damaging 0.99
R7945:Ush1c UTSW 7 46221424 missense probably damaging 0.99
R8182:Ush1c UTSW 7 46198351 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- TAGCACTGAGAGCACAACCG -3'
(R):5'- AGGCTGTGAATGTCCTGAAG -3'

Sequencing Primer
(F):5'- CAGGCAGAAGTCAGTTGTGTC -3'
(R):5'- CTGTGAATGTCCTGAAGAGCAGC -3'
Posted On2015-05-15