Incidental Mutation 'R4042:Ppme1'
ID315772
Institutional Source Beutler Lab
Gene Symbol Ppme1
Ensembl Gene ENSMUSG00000030718
Gene Nameprotein phosphatase methylesterase 1
Synonyms1110069N17Rik, PME-1, 2700017M01Rik
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100326737-100372307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100341065 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 226 (S226P)
Ref Sequence ENSEMBL: ENSMUSP00000032963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032963]
Predicted Effect probably damaging
Transcript: ENSMUST00000032963
AA Change: S226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032963
Gene: ENSMUSG00000030718
AA Change: S226P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Hydrolase_4 73 199 5.2e-13 PFAM
Pfam:Abhydrolase_1 77 356 7.4e-17 PFAM
Pfam:Abhydrolase_5 78 259 1.3e-14 PFAM
Pfam:Abhydrolase_6 79 362 2.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207092
Predicted Effect unknown
Transcript: ENSMUST00000207634
AA Change: S74P
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: Targeted disruption of this gene causes virtual loss of the demethylated form of phosphoprotein phosphatase 2A in the nervous system and peripheral tissues. Homozygous null mice fail to initiate normal breathing or suckling behavior and die within the first day of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Ppme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Ppme1 APN 7 100333932 missense probably damaging 1.00
IGL02957:Ppme1 APN 7 100338440 missense possibly damaging 0.93
R0328:Ppme1 UTSW 7 100333975 splice site probably null
R3015:Ppme1 UTSW 7 100331877 missense probably damaging 1.00
R4090:Ppme1 UTSW 7 100347837 missense possibly damaging 0.85
R4987:Ppme1 UTSW 7 100345071 missense probably benign 0.01
R5579:Ppme1 UTSW 7 100344975 missense probably damaging 1.00
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6374:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R6462:Ppme1 UTSW 7 100338392 missense probably benign 0.01
R7092:Ppme1 UTSW 7 100371822 start codon destroyed probably null 0.53
R7468:Ppme1 UTSW 7 100341862 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATTGGCTAGCCTAACAGAACTC -3'
(R):5'- GCTTCTGTTAAAGGCTGTCAATCATG -3'

Sequencing Primer
(F):5'- TGGCTAGCCTAACAGAACTCAACTTG -3'
(R):5'- ATGCTGAAGCACATGGTG -3'
Posted On2015-05-15