Incidental Mutation 'R4042:Mettl16'
ID315777
Institutional Source Beutler Lab
Gene Symbol Mettl16
Ensembl Gene ENSMUSG00000010554
Gene Namemethyltransferase like 16
Synonyms2810013M15Rik, Mett10d, 2610100D03Rik, A830095F14Rik
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74770830-74828525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74792292 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 187 (F187I)
Ref Sequence ENSEMBL: ENSMUSP00000114682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010698] [ENSMUST00000092912] [ENSMUST00000141755]
Predicted Effect probably damaging
Transcript: ENSMUST00000010698
AA Change: F187I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010698
Gene: ENSMUSG00000010554
AA Change: F187I

DomainStartEndE-ValueType
Pfam:Methyltransf_10 1 268 2.9e-114 PFAM
Pfam:MTS 92 202 1.8e-7 PFAM
Pfam:Methyltransf_10 276 331 5.5e-21 PFAM
low complexity region 421 437 N/A INTRINSIC
low complexity region 497 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092912
AA Change: F187I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090590
Gene: ENSMUSG00000010554
AA Change: F187I

DomainStartEndE-ValueType
Pfam:Methyltransf_10 1 211 7.8e-97 PFAM
Pfam:PrmA 85 185 6.5e-7 PFAM
Pfam:MTS 92 200 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141755
AA Change: F187I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114682
Gene: ENSMUSG00000010554
AA Change: F187I

DomainStartEndE-ValueType
Pfam:Methyltransf_10 1 291 4.8e-138 PFAM
low complexity region 381 397 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Mettl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Mettl16 APN 11 74817366 missense probably benign 0.11
IGL01538:Mettl16 APN 11 74792267 nonsense probably null
IGL01893:Mettl16 APN 11 74805271 missense possibly damaging 0.84
IGL02079:Mettl16 APN 11 74817624 missense probably damaging 1.00
IGL03217:Mettl16 APN 11 74817703 missense probably damaging 1.00
R2014:Mettl16 UTSW 11 74817369 missense probably benign
R2117:Mettl16 UTSW 11 74802929 missense probably benign
R4773:Mettl16 UTSW 11 74817301 missense possibly damaging 0.49
R5031:Mettl16 UTSW 11 74802999 missense probably benign
R5056:Mettl16 UTSW 11 74816940 missense probably benign 0.34
R5951:Mettl16 UTSW 11 74795997 missense possibly damaging 0.71
R5986:Mettl16 UTSW 11 74792237 missense possibly damaging 0.51
R6012:Mettl16 UTSW 11 74787648 missense probably damaging 1.00
R6314:Mettl16 UTSW 11 74796006 nonsense probably null
R6450:Mettl16 UTSW 11 74805338 missense probably benign 0.02
R7744:Mettl16 UTSW 11 74803003 missense probably benign 0.08
R8086:Mettl16 UTSW 11 74805265 missense probably benign 0.03
X0012:Mettl16 UTSW 11 74817025 missense probably benign 0.02
X0028:Mettl16 UTSW 11 74817044 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTTTACACACAGGCTTGCCG -3'
(R):5'- CTGTTGAACTGGGAAGTCTATCTG -3'

Sequencing Primer
(F):5'- ACACAGGCTTGCCGTCATTTTC -3'
(R):5'- AAGCTAGCTAAGCATTTGG -3'
Posted On2015-05-15