Incidental Mutation 'R4042:Krt10'
ID315778
Institutional Source Beutler Lab
Gene Symbol Krt10
Ensembl Gene ENSMUSG00000019761
Gene Namekeratin 10
SynonymsKrt1-10, suprabasal cytokeratin 10, K10, Krt-1.10, keratin 10, D130054E02Rik, cytokeratin 10, K1C1
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99385254-99389364 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 99386993 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103131] [ENSMUST00000211768]
Predicted Effect probably null
Transcript: ENSMUST00000103131
SMART Domains Protein: ENSMUSP00000099420
Gene: ENSMUSG00000019761

DomainStartEndE-ValueType
low complexity region 2 133 N/A INTRINSIC
Filament 134 448 6e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153599
Predicted Effect probably benign
Transcript: ENSMUST00000211768
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations may result in hyperkeratosis and blistering of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Krt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Krt10 APN 11 99389218 unclassified probably benign
Rough-fur UTSW 11 99388818 missense probably damaging 0.99
FR4304:Krt10 UTSW 11 99386199 unclassified probably benign
FR4304:Krt10 UTSW 11 99389274 unclassified probably benign
FR4340:Krt10 UTSW 11 99386202 unclassified probably benign
FR4340:Krt10 UTSW 11 99386203 unclassified probably benign
FR4340:Krt10 UTSW 11 99389274 unclassified probably benign
FR4342:Krt10 UTSW 11 99386199 unclassified probably benign
FR4342:Krt10 UTSW 11 99386203 unclassified probably benign
FR4449:Krt10 UTSW 11 99389267 unclassified probably benign
FR4548:Krt10 UTSW 11 99389273 unclassified probably benign
FR4548:Krt10 UTSW 11 99389276 unclassified probably benign
FR4589:Krt10 UTSW 11 99389276 unclassified probably benign
FR4737:Krt10 UTSW 11 99386197 unclassified probably benign
FR4737:Krt10 UTSW 11 99389273 unclassified probably benign
FR4737:Krt10 UTSW 11 99389279 unclassified probably benign
R1386:Krt10 UTSW 11 99385920 splice site probably benign
R1553:Krt10 UTSW 11 99385980 nonsense probably null
R1737:Krt10 UTSW 11 99387387 missense possibly damaging 0.81
R2082:Krt10 UTSW 11 99388875 missense probably damaging 1.00
R2420:Krt10 UTSW 11 99387107 missense possibly damaging 0.53
R3409:Krt10 UTSW 11 99387261 missense probably damaging 1.00
R4027:Krt10 UTSW 11 99386193 unclassified probably benign
R4043:Krt10 UTSW 11 99386993 splice site probably null
R4915:Krt10 UTSW 11 99387508 missense probably damaging 0.99
R5818:Krt10 UTSW 11 99388771 missense probably damaging 1.00
R6546:Krt10 UTSW 11 99387395 splice site probably null
R6762:Krt10 UTSW 11 99387057 missense possibly damaging 0.90
R6925:Krt10 UTSW 11 99388851 missense probably damaging 0.99
R6985:Krt10 UTSW 11 99385630 missense possibly damaging 0.66
R7196:Krt10 UTSW 11 99387545 missense probably damaging 1.00
R7772:Krt10 UTSW 11 99389087 missense unknown
R7849:Krt10 UTSW 11 99387606 missense probably damaging 1.00
R7932:Krt10 UTSW 11 99387606 missense probably damaging 1.00
RF057:Krt10 UTSW 11 99386199 unclassified probably benign
RF062:Krt10 UTSW 11 99386199 unclassified probably benign
RF062:Krt10 UTSW 11 99389264 unclassified probably benign
X0024:Krt10 UTSW 11 99388022 missense probably damaging 1.00
X0062:Krt10 UTSW 11 99387499 missense probably null 1.00
Z1177:Krt10 UTSW 11 99386232 missense unknown
Predicted Primers PCR Primer
(F):5'- TAAATTAGGATTCGTGCTAGGCTG -3'
(R):5'- TCTTAGTGAAGCCCATGGAGC -3'

Sequencing Primer
(F):5'- TGCACTGCCAAAGTTTGAGC -3'
(R):5'- GTCCAGCCATAAGTCTGAAA -3'
Posted On2015-05-15