Incidental Mutation 'R4042:Cog1'
ID315779
Institutional Source Beutler Lab
Gene Symbol Cog1
Ensembl Gene ENSMUSG00000018661
Gene Namecomponent of oligomeric golgi complex 1
Synonyms
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location113649169-113667054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113661010 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 156 (Q156L)
Ref Sequence ENSEMBL: ENSMUSP00000115773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018805] [ENSMUST00000063776] [ENSMUST00000120194] [ENSMUST00000148736] [ENSMUST00000152653]
Predicted Effect probably damaging
Transcript: ENSMUST00000018805
AA Change: Q894L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018805
Gene: ENSMUSG00000018661
AA Change: Q894L

DomainStartEndE-ValueType
Pfam:Vps51 12 93 1.5e-17 PFAM
low complexity region 95 110 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063776
AA Change: Q310L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068394
Gene: ENSMUSG00000018661
AA Change: Q310L

DomainStartEndE-ValueType
Pfam:Vps51 12 93 4.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120194
SMART Domains Protein: ENSMUSP00000113652
Gene: ENSMUSG00000041629

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
Pfam:FAM104 75 185 3.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123085
Predicted Effect unknown
Transcript: ENSMUST00000134418
AA Change: R97W
Predicted Effect unknown
Transcript: ENSMUST00000137878
AA Change: Q54L
Predicted Effect unknown
Transcript: ENSMUST00000142069
AA Change: Q110L
Predicted Effect probably damaging
Transcript: ENSMUST00000148736
AA Change: Q156L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000152653
AA Change: R62W

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. It is thought that this protein is required for steps in the normal medial and trans Golgi-associated processing of glycoconjugates and plays a role in the organization of the Golgi-localized complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Cog1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Cog1 APN 11 113654026 missense probably benign 0.02
IGL02631:Cog1 APN 11 113656478 nonsense probably null
IGL03258:Cog1 APN 11 113655093 nonsense probably null
R0243:Cog1 UTSW 11 113656995 unclassified probably benign
R0336:Cog1 UTSW 11 113662250 missense probably benign 0.28
R1061:Cog1 UTSW 11 113652037 missense probably benign
R1539:Cog1 UTSW 11 113652232 missense possibly damaging 0.93
R1757:Cog1 UTSW 11 113652304 missense possibly damaging 0.71
R1782:Cog1 UTSW 11 113653966 missense probably benign
R1924:Cog1 UTSW 11 113656212 missense probably benign
R2120:Cog1 UTSW 11 113649598 missense probably damaging 0.98
R2121:Cog1 UTSW 11 113649598 missense probably damaging 0.98
R2137:Cog1 UTSW 11 113659301 missense probably damaging 1.00
R3809:Cog1 UTSW 11 113655010 missense probably benign
R4287:Cog1 UTSW 11 113654027 missense probably damaging 0.99
R4679:Cog1 UTSW 11 113652290 missense probably damaging 1.00
R4716:Cog1 UTSW 11 113657097 missense probably damaging 1.00
R4774:Cog1 UTSW 11 113657427 missense possibly damaging 0.84
R6575:Cog1 UTSW 11 113656061 missense probably benign 0.36
R7026:Cog1 UTSW 11 113649589 missense probably damaging 1.00
R7233:Cog1 UTSW 11 113649730 missense probably damaging 1.00
R8013:Cog1 UTSW 11 113656164 missense probably damaging 1.00
R8014:Cog1 UTSW 11 113656164 missense probably damaging 1.00
R8027:Cog1 UTSW 11 113652389 missense probably damaging 1.00
R8865:Cog1 UTSW 11 113658498 missense probably benign 0.33
Z1176:Cog1 UTSW 11 113651982 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTACATTTTCCCAAACAAAGGTTAAA -3'
(R):5'- TTGGGTTTCAACGCTTCTACTGG -3'

Sequencing Primer
(F):5'- CAGCCTGGTCTATAAAGTGAGTTCC -3'
(R):5'- AACGCTTCTACTGGTTGCC -3'
Posted On2015-05-15