Incidental Mutation 'R4042:Bcl2l2'
ID315786
Institutional Source Beutler Lab
Gene Symbol Bcl2l2
Ensembl Gene ENSMUSG00000089682
Gene NameBCL2-like 2
SynonymsGtrosa41, bclw, Bcl-w, Gtrgal2
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R4042 (G1)
Quality Score222
Status Not validated
Chromosome14
Chromosomal Location54883377-54888234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54884634 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 85 (E85K)
Ref Sequence ENSEMBL: ENSMUSP00000116385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022806] [ENSMUST00000133397] [ENSMUST00000134077] [ENSMUST00000172844] [ENSMUST00000227108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022806
AA Change: E85K

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022806
Gene: ENSMUSG00000089682
AA Change: E85K

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 172 188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131243
Predicted Effect possibly damaging
Transcript: ENSMUST00000133397
AA Change: E85K

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116385
Gene: ENSMUSG00000089682
AA Change: E85K

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134077
AA Change: E85K

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232
AA Change: E85K

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172844
SMART Domains Protein: ENSMUSP00000133286
Gene: ENSMUSG00000089682

DomainStartEndE-ValueType
Pfam:Bcl-2 1 30 3.9e-7 PFAM
Blast:BCL 31 53 1e-7 BLAST
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194113
Predicted Effect possibly damaging
Transcript: ENSMUST00000227108
AA Change: E85K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mutants are male sterile with progressive loss of germ cells, Sertoli cells and Leydig cells beginning at puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Bcl2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03126:Bcl2l2 APN 14 54884767 missense probably damaging 1.00
R2656:Bcl2l2 UTSW 14 54885432 missense probably benign 0.02
R5278:Bcl2l2 UTSW 14 54884794 missense probably damaging 0.98
R6129:Bcl2l2 UTSW 14 54884745 missense possibly damaging 0.86
R6234:Bcl2l2 UTSW 14 54884788 missense probably benign 0.00
R7205:Bcl2l2 UTSW 14 54884601 missense probably benign
R7747:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7748:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7779:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7845:Bcl2l2 UTSW 14 54884851 missense unknown
R7855:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7928:Bcl2l2 UTSW 14 54884851 missense unknown
R7938:Bcl2l2 UTSW 14 54884379 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTGTAGGCTATAAGCTGAGGC -3'
(R):5'- TGAGAACTTCTTACCCAGCCC -3'

Sequencing Primer
(F):5'- CTGAGGCAGAAGGGTTATGTC -3'
(R):5'- TTACCCAGCCCCCACTG -3'
Posted On2015-05-15