Incidental Mutation 'R4042:Cyp2d10'
ID315789
Institutional Source Beutler Lab
Gene Symbol Cyp2d10
Ensembl Gene ENSMUSG00000094806
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 10
SynonymsCyp2d, P450-2D
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82402846-82407195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82406068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 67 (R67H)
Ref Sequence ENSEMBL: ENSMUSP00000155800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072776] [ENSMUST00000229628] [ENSMUST00000229911] [ENSMUST00000230198] [ENSMUST00000230248] [ENSMUST00000230843]
Predicted Effect probably benign
Transcript: ENSMUST00000072776
AA Change: R67H

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072555
Gene: ENSMUSG00000094806
AA Change: R67H

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:p450 37 497 6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183705
Predicted Effect probably benign
Transcript: ENSMUST00000229628
AA Change: R67H

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000229911
AA Change: R67H

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000230198
AA Change: R67H

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000230248
AA Change: R67H

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000230843
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adamts10 A G 17: 33,549,540 H864R possibly damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Cyp2d10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Cyp2d10 APN 15 82403314 missense possibly damaging 0.71
IGL00840:Cyp2d10 APN 15 82404490 missense probably benign 0.40
IGL01293:Cyp2d10 APN 15 82403009 missense possibly damaging 0.92
IGL01339:Cyp2d10 APN 15 82403841 missense probably benign 0.33
IGL01871:Cyp2d10 APN 15 82403885 missense probably damaging 1.00
IGL02132:Cyp2d10 APN 15 82404607 intron probably benign
IGL02713:Cyp2d10 APN 15 82406082 unclassified probably benign
IGL02869:Cyp2d10 APN 15 82403868 missense possibly damaging 0.84
R0102:Cyp2d10 UTSW 15 82404593 missense probably benign 0.01
R0102:Cyp2d10 UTSW 15 82404593 missense probably benign 0.01
R0279:Cyp2d10 UTSW 15 82405339 missense possibly damaging 0.94
R0331:Cyp2d10 UTSW 15 82407026 missense probably benign 0.12
R1344:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1418:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1465:Cyp2d10 UTSW 15 82403928 intron probably null
R1465:Cyp2d10 UTSW 15 82403928 intron probably null
R1706:Cyp2d10 UTSW 15 82405582 missense probably damaging 0.96
R1712:Cyp2d10 UTSW 15 82403039 missense probably damaging 1.00
R1940:Cyp2d10 UTSW 15 82405294 missense probably benign 0.13
R1983:Cyp2d10 UTSW 15 82405999 missense probably benign 0.15
R2056:Cyp2d10 UTSW 15 82403814 missense probably damaging 1.00
R2058:Cyp2d10 UTSW 15 82403814 missense probably damaging 1.00
R3707:Cyp2d10 UTSW 15 82403016 missense possibly damaging 0.91
R3708:Cyp2d10 UTSW 15 82403016 missense possibly damaging 0.91
R4531:Cyp2d10 UTSW 15 82405261 missense probably benign 0.31
R4694:Cyp2d10 UTSW 15 82404483 missense probably damaging 1.00
R4869:Cyp2d10 UTSW 15 82403766 missense probably benign 0.00
R5071:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5072:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5073:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5074:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5746:Cyp2d10 UTSW 15 82405271 missense probably benign 0.38
R7096:Cyp2d10 UTSW 15 82405261 missense probably benign
R7212:Cyp2d10 UTSW 15 82404246 critical splice acceptor site probably null
R7324:Cyp2d10 UTSW 15 82403760 missense probably damaging 0.97
R7487:Cyp2d10 UTSW 15 82404592 missense probably benign 0.00
X0063:Cyp2d10 UTSW 15 82406000 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATTCCCACACGTCTGAACC -3'
(R):5'- TGGAGTCACATACACATATGCAC -3'

Sequencing Primer
(F):5'- GTCTGAACCCAAATCCACCGTC -3'
(R):5'- GTCACATACACATATGCACACATAC -3'
Posted On2015-05-15