Incidental Mutation 'R4042:Adamts10'
ID315791
Institutional Source Beutler Lab
Gene Symbol Adamts10
Ensembl Gene ENSMUSG00000024299
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
SynonymsZnMP
MMRRC Submission 040851-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R4042 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33524204-33553782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33549540 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 864 (H864R)
Ref Sequence ENSEMBL: ENSMUSP00000084905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087623] [ENSMUST00000172922] [ENSMUST00000173013] [ENSMUST00000173030] [ENSMUST00000173241] [ENSMUST00000173931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087623
AA Change: H864R

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084905
Gene: ENSMUSG00000024299
AA Change: H864R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 180 1.3e-33 PFAM
Pfam:Reprolysin_5 237 432 5e-15 PFAM
Pfam:Reprolysin_4 237 448 5e-11 PFAM
Pfam:Reprolysin 239 457 1.6e-25 PFAM
Pfam:Reprolysin_2 257 447 1.2e-13 PFAM
Pfam:Reprolysin_3 261 403 5.7e-13 PFAM
TSP1 550 602 7.21e-11 SMART
Pfam:ADAM_spacer1 706 818 1.3e-27 PFAM
TSP1 828 885 4.73e-6 SMART
TSP1 887 940 4.35e-2 SMART
TSP1 948 1003 2.66e-2 SMART
TSP1 1006 1058 9.98e-5 SMART
Pfam:PLAC 1070 1102 8.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172922
SMART Domains Protein: ENSMUSP00000133891
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 1.1e-30 PFAM
SCOP:d1bkca_ 238 271 4e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173013
SMART Domains Protein: ENSMUSP00000134181
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173030
SMART Domains Protein: ENSMUSP00000134549
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173241
SMART Domains Protein: ENSMUSP00000134298
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173931
SMART Domains Protein: ENSMUSP00000133434
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174104
Predicted Effect probably benign
Transcript: ENSMUST00000174348
SMART Domains Protein: ENSMUSP00000133856
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
Pfam:Reprolysin_5 23 220 2.6e-16 PFAM
Pfam:Reprolysin_4 23 235 2.6e-12 PFAM
Pfam:Reprolysin 25 243 1e-26 PFAM
Pfam:Reprolysin_2 43 233 7.1e-15 PFAM
Pfam:Reprolysin_3 47 189 4.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174666
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate a functional, zinc-dependent metallopeptidase enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Akap6 A T 12: 53,139,379 probably null Het
Alox5 A G 6: 116,461,018 S3P possibly damaging Het
Bcl2l2 G A 14: 54,884,634 E85K possibly damaging Het
Chd6 A T 2: 160,988,333 I1014N probably damaging Het
Cog1 A T 11: 113,661,010 Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 S909F probably damaging Het
Csmd3 C T 15: 47,614,084 G3339D probably damaging Het
Cst11 A G 2: 148,771,280 S42P probably benign Het
Cyp2d10 C T 15: 82,406,068 R67H probably benign Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Homo
Fsip2 G T 2: 82,983,552 R3405L probably benign Het
H2-Ab1 T C 17: 34,264,860 V65A probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Insrr T A 3: 87,813,827 M1095K probably damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Krt10 C T 11: 99,386,993 probably null Het
Mettl16 T A 11: 74,792,292 F187I probably damaging Het
Miga2 T C 2: 30,367,726 I12T possibly damaging Het
Muc5b T C 7: 141,864,887 Y3857H possibly damaging Het
Ncoa1 A G 12: 4,267,871 S165P probably damaging Het
Olfr1432 A T 19: 12,229,312 I83N probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plxnb1 A G 9: 109,105,173 D823G probably benign Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Prune2 T C 19: 17,003,826 probably null Het
Rgl2 C T 17: 33,937,262 R775W probably damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Rrm2 T C 12: 24,711,451 Y162H probably benign Het
Syne1 T C 10: 5,041,584 M8377V probably benign Het
Uchl4 A C 9: 64,235,557 I107L probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Ythdc1 T C 5: 86,816,524 I76T probably benign Het
Other mutations in Adamts10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Adamts10 APN 17 33543231 missense probably benign 0.24
IGL01865:Adamts10 APN 17 33553166 missense probably damaging 0.99
IGL02391:Adamts10 APN 17 33528811 missense probably benign 0.00
IGL02711:Adamts10 APN 17 33538272 missense probably damaging 0.99
R0122:Adamts10 UTSW 17 33528480 unclassified probably benign
R0207:Adamts10 UTSW 17 33545390 missense possibly damaging 0.64
R0481:Adamts10 UTSW 17 33549373 nonsense probably null
R0508:Adamts10 UTSW 17 33543718 missense probably damaging 1.00
R0558:Adamts10 UTSW 17 33550609 missense probably benign 0.04
R0746:Adamts10 UTSW 17 33549547 nonsense probably null
R1027:Adamts10 UTSW 17 33543763 missense probably benign 0.44
R1449:Adamts10 UTSW 17 33545639 missense probably damaging 0.96
R1471:Adamts10 UTSW 17 33553138 missense probably damaging 1.00
R1522:Adamts10 UTSW 17 33537319 missense probably benign 0.40
R1631:Adamts10 UTSW 17 33537342 missense probably benign 0.25
R1863:Adamts10 UTSW 17 33551432 critical splice donor site probably null
R1913:Adamts10 UTSW 17 33549555 missense probably benign 0.00
R2091:Adamts10 UTSW 17 33551192 critical splice donor site probably null
R2377:Adamts10 UTSW 17 33528892 missense probably damaging 1.00
R3743:Adamts10 UTSW 17 33528712 missense probably damaging 1.00
R4646:Adamts10 UTSW 17 33545555 missense probably damaging 1.00
R4654:Adamts10 UTSW 17 33537330 missense possibly damaging 0.89
R4695:Adamts10 UTSW 17 33531739 missense possibly damaging 0.95
R4721:Adamts10 UTSW 17 33545537 splice site probably null
R4798:Adamts10 UTSW 17 33528752 missense probably damaging 1.00
R4896:Adamts10 UTSW 17 33528896 missense possibly damaging 0.90
R7454:Adamts10 UTSW 17 33545005 missense possibly damaging 0.89
R7494:Adamts10 UTSW 17 33549378 nonsense probably null
R7541:Adamts10 UTSW 17 33531616 missense probably benign 0.00
R7704:Adamts10 UTSW 17 33551152 missense probably damaging 1.00
R8154:Adamts10 UTSW 17 33537928 missense probably damaging 1.00
Z1176:Adamts10 UTSW 17 33528787 missense probably damaging 1.00
Z1176:Adamts10 UTSW 17 33528788 missense probably damaging 1.00
Z1177:Adamts10 UTSW 17 33545429 missense possibly damaging 0.76
Z1177:Adamts10 UTSW 17 33545594 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATGCTCAGCCCAGTGTG -3'
(R):5'- TGACCCCTTGACCCTATGAG -3'

Sequencing Primer
(F):5'- CAGTGTGCAGGCGGTGAG -3'
(R):5'- ATGAGCTCCTTACCTCCAATAC -3'
Posted On2015-05-15