Incidental Mutation 'R4042:Or5bb10'
ID 315794
Institutional Source Beutler Lab
Gene Symbol Or5bb10
Ensembl Gene ENSMUSG00000109022
Gene Name olfactory receptor family 5 subfamily BB member 10
Synonyms Olfr1432, MOR202-32P, GA_x6K02T2RE5P-2593538-2592756
MMRRC Submission 040851-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R4042 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12205883-12206926 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12206676 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 83 (I83N)
Ref Sequence ENSEMBL: ENSMUSP00000146529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180978] [ENSMUST00000207710]
AlphaFold A0A140LHS7
Predicted Effect probably benign
Transcript: ENSMUST00000180978
AA Change: I78N

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000207710
AA Change: I83N

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 A G 17: 33,768,514 (GRCm39) H864R possibly damaging Het
Akap6 A T 12: 53,186,162 (GRCm39) probably null Het
Alox5 A G 6: 116,437,979 (GRCm39) S3P possibly damaging Het
Bcl2l2 G A 14: 55,122,091 (GRCm39) E85K possibly damaging Het
Chd6 A T 2: 160,830,253 (GRCm39) I1014N probably damaging Het
Cog1 A T 11: 113,551,836 (GRCm39) Q156L probably damaging Het
Col28a1 G A 6: 8,014,678 (GRCm39) S909F probably damaging Het
Csmd3 C T 15: 47,477,480 (GRCm39) G3339D probably damaging Het
Cst11 A G 2: 148,613,200 (GRCm39) S42P probably benign Het
Cyp2d10 C T 15: 82,290,269 (GRCm39) R67H probably benign Het
Fsip2 G T 2: 82,813,896 (GRCm39) R3405L probably benign Het
H2-Ab1 T C 17: 34,483,834 (GRCm39) V65A probably benign Het
Hdac6 T C X: 7,797,731 (GRCm39) T993A probably benign Het
Insrr T A 3: 87,721,134 (GRCm39) M1095K probably damaging Het
Itih4 A T 14: 30,616,995 (GRCm39) N517I probably damaging Het
Krt10 C T 11: 99,277,819 (GRCm39) probably null Het
Mettl16 T A 11: 74,683,118 (GRCm39) F187I probably damaging Het
Miga2 T C 2: 30,257,738 (GRCm39) I12T possibly damaging Het
Muc5b T C 7: 141,418,624 (GRCm39) Y3857H possibly damaging Het
Ncoa1 A G 12: 4,317,871 (GRCm39) S165P probably damaging Het
Otol1 A G 3: 69,935,112 (GRCm39) D368G probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Plxnb1 A G 9: 108,934,241 (GRCm39) D823G probably benign Het
Ppme1 A G 7: 99,990,272 (GRCm39) S226P probably damaging Het
Ppp4r3c1 A G X: 88,975,909 (GRCm39) F96S probably damaging Het
Prss40 G T 1: 34,599,960 (GRCm39) S9* probably null Het
Prune2 T C 19: 16,981,190 (GRCm39) probably null Het
Radx C T X: 138,407,752 (GRCm39) S364L probably damaging Homo
Rgl2 C T 17: 34,156,236 (GRCm39) R775W probably damaging Het
Rpp40 A G 13: 36,082,549 (GRCm39) C275R probably benign Het
Rrm2 T C 12: 24,761,450 (GRCm39) Y162H probably benign Het
Spata6l A T 19: 28,923,183 (GRCm39) C80S possibly damaging Het
Syne1 T C 10: 4,991,584 (GRCm39) M8377V probably benign Het
Uchl4 A C 9: 64,142,839 (GRCm39) I107L probably benign Het
Ush1c T C 7: 45,870,952 (GRCm39) E276G probably damaging Het
Usp34 C T 11: 23,439,033 (GRCm39) P3532S possibly damaging Het
Vcan T A 13: 89,840,662 (GRCm39) L1627F probably benign Het
Ythdc1 T C 5: 86,964,383 (GRCm39) I76T probably benign Het
Other mutations in Or5bb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1586:Or5bb10 UTSW 19 12,206,241 (GRCm39) missense probably damaging 0.97
Z1088:Or5bb10 UTSW 19 12,206,588 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGCTGAGTACTGCAGAG -3'
(R):5'- AGATGGAAACCACACCTCTGTG -3'

Sequencing Primer
(F):5'- CTGAGTACTGCAGAGGGCTAC -3'
(R):5'- CTCTTGGACCAAGCTGAGCTG -3'
Posted On 2015-05-15