Incidental Mutation 'R4060:Cntn2'
ID315801
Institutional Source Beutler Lab
Gene Symbol Cntn2
Ensembl Gene ENSMUSG00000053024
Gene Namecontactin 2
Synonymsaxonin, Tax, TAG-1, D130012K04Rik
MMRRC Submission 041618-MU
Accession Numbers

Ncbi RefSeq: NM_177129.5; MGI:104518

Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132509427-132543256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132525896 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 346 (L346F)
Ref Sequence ENSEMBL: ENSMUSP00000083707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086521] [ENSMUST00000188943]
Predicted Effect probably damaging
Transcript: ENSMUST00000086521
AA Change: L346F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024
AA Change: L346F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect probably benign
Transcript: ENSMUST00000188065
Predicted Effect probably benign
Transcript: ENSMUST00000188943
SMART Domains Protein: ENSMUSP00000139795
Gene: ENSMUSG00000053024

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PDB:2OM5|A 36 103 9e-37 PDB
SCOP:d1cs6a1 36 103 2e-11 SMART
Blast:IGc2 54 103 1e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype Strain: 2181052; 2677610; 3521785
FUNCTION: This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. Mice lacking a functional copy of this gene exhibit epileptic seizures and elevated expression of A1 adenosine receptors. [provided by RefSeq, Sep 2016]
PHENOTYPE: Targeted mutation of this locus results in molecular abnormalities in the central nervous system. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Cntn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Cntn2 APN 1 132521884 splice site probably benign
IGL01137:Cntn2 APN 1 132521297 splice site probably benign
IGL01339:Cntn2 APN 1 132518905 splice site probably null
IGL01369:Cntn2 APN 1 132516105 missense probably benign
IGL01572:Cntn2 APN 1 132528171 missense probably damaging 1.00
IGL02389:Cntn2 APN 1 132525321 missense probably damaging 0.99
IGL02473:Cntn2 APN 1 132518331 missense probably benign
IGL02550:Cntn2 APN 1 132529063 missense probably null 0.03
IGL02608:Cntn2 APN 1 132525916 missense possibly damaging 0.87
IGL02755:Cntn2 APN 1 132529302 missense probably benign 0.43
IGL02850:Cntn2 APN 1 132518376 missense probably benign 0.00
IGL02887:Cntn2 APN 1 132516570 missense probably damaging 0.96
IGL03060:Cntn2 APN 1 132528940 missense probably benign 0.03
IGL03224:Cntn2 APN 1 132523042 missense probably damaging 1.00
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0270:Cntn2 UTSW 1 132521724 missense probably damaging 1.00
R0739:Cntn2 UTSW 1 132529012 missense probably damaging 1.00
R0849:Cntn2 UTSW 1 132522386 missense probably benign 0.09
R0903:Cntn2 UTSW 1 132533684 small deletion probably benign
R1463:Cntn2 UTSW 1 132521137 critical splice donor site probably null
R1512:Cntn2 UTSW 1 132523692 missense probably damaging 0.99
R1535:Cntn2 UTSW 1 132525384 missense probably benign 0.26
R1686:Cntn2 UTSW 1 132526311 missense possibly damaging 0.78
R1696:Cntn2 UTSW 1 132521279 missense probably damaging 0.96
R1708:Cntn2 UTSW 1 132519198 missense probably damaging 0.96
R2251:Cntn2 UTSW 1 132525321 missense probably damaging 0.99
R2315:Cntn2 UTSW 1 132522997 missense probably benign 0.00
R2395:Cntn2 UTSW 1 132526372 missense probably benign
R3617:Cntn2 UTSW 1 132528623 missense probably benign 0.16
R3883:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R3884:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R4289:Cntn2 UTSW 1 132527743 missense probably benign 0.01
R4710:Cntn2 UTSW 1 132528225 missense possibly damaging 0.84
R4921:Cntn2 UTSW 1 132516032 missense possibly damaging 0.49
R5121:Cntn2 UTSW 1 132517060 nonsense probably null
R5288:Cntn2 UTSW 1 132523677 missense probably benign 0.18
R5360:Cntn2 UTSW 1 132518857 missense probably damaging 0.97
R5787:Cntn2 UTSW 1 132523059 missense probably damaging 1.00
R5817:Cntn2 UTSW 1 132518748 missense probably benign 0.21
R5930:Cntn2 UTSW 1 132523432 missense probably damaging 1.00
R6053:Cntn2 UTSW 1 132518352 missense probably benign 0.18
R7189:Cntn2 UTSW 1 132517086 missense probably damaging 1.00
R7352:Cntn2 UTSW 1 132522399 missense probably benign 0.02
R7562:Cntn2 UTSW 1 132526317 missense possibly damaging 0.67
R7689:Cntn2 UTSW 1 132516144 missense probably benign 0.00
R7764:Cntn2 UTSW 1 132522363 missense probably benign 0.21
X0018:Cntn2 UTSW 1 132533684 small deletion probably benign
Z1176:Cntn2 UTSW 1 132527788 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGAGAAGAAGCACCAG -3'
(R):5'- TTGCTAAATCAGTCCCTGGC -3'

Sequencing Primer
(F):5'- TGAGAAGAAGCACCAGAACGTCC -3'
(R):5'- ACCAGAGAGTGCCAGCTTCTTC -3'
Posted On2015-05-15