Incidental Mutation 'R4060:Foxo1'
ID315810
Institutional Source Beutler Lab
Gene Symbol Foxo1
Ensembl Gene ENSMUSG00000044167
Gene Nameforkhead box O1
SynonymsFoxo1a, FKHR, Fkhr1, Afxh
MMRRC Submission 041618-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location52268336-52353221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52345162 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 249 (R249G)
Ref Sequence ENSEMBL: ENSMUSP00000055308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053764]
Predicted Effect probably damaging
Transcript: ENSMUST00000053764
AA Change: R249G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055308
Gene: ENSMUSG00000044167
AA Change: R249G

DomainStartEndE-ValueType
low complexity region 35 67 N/A INTRINSIC
low complexity region 88 96 N/A INTRINSIC
low complexity region 114 146 N/A INTRINSIC
FH 155 245 4.4e-43 SMART
low complexity region 258 273 N/A INTRINSIC
low complexity region 370 391 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:FOXO_KIX_bdg 420 501 2.6e-33 PFAM
Pfam:FOXO-TAD 592 632 4.9e-22 PFAM
Meta Mutation Damage Score 0.4494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in myogenic growth and differentiation. Translocation of this gene with PAX3 has been associated with alveolar rhabdomyosarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die at E10.5-E11.5 from vasculature defects. Heterozygote null mice have slightly elevated glycogen levels. Conditionally targeted homozygotes display hemangiomas or defects in na�ve T cell homeostasis depending on the targeted cell type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Foxo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Foxo1 APN 3 52345159 missense probably damaging 1.00
R1595:Foxo1 UTSW 3 52345954 missense probably benign 0.00
R2265:Foxo1 UTSW 3 52345912 missense probably benign 0.00
R2567:Foxo1 UTSW 3 52269334 missense probably damaging 1.00
R3845:Foxo1 UTSW 3 52346280 missense probably benign 0.39
R4179:Foxo1 UTSW 3 52345419 missense probably benign 0.40
R4270:Foxo1 UTSW 3 52345405 missense probably benign 0.45
R5242:Foxo1 UTSW 3 52269255 missense probably damaging 1.00
R5380:Foxo1 UTSW 3 52269025 missense probably damaging 1.00
R6044:Foxo1 UTSW 3 52345837 missense probably benign 0.22
R6224:Foxo1 UTSW 3 52345672 missense probably benign 0.00
R8041:Foxo1 UTSW 3 52345623 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTAGGCTGCTCAGAATGG -3'
(R):5'- TATCAAAGTCATCGTTGCTGTGG -3'

Sequencing Primer
(F):5'- TCTGATCCCCATTGAGCAGTAAG -3'
(R):5'- TCATCGTTGCTGTGGGACCC -3'
Posted On2015-05-15