Incidental Mutation 'R4060:Trbv20'
ID315813
Institutional Source Beutler Lab
Gene Symbol Trbv20
Ensembl Gene ENSMUSG00000076476
Gene NameT cell receptor beta, variable 20
SynonymsTcrb-V15, Gm16911
MMRRC Submission 041618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41188273-41188977 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 41188261 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103277]
Predicted Effect probably benign
Transcript: ENSMUST00000103277
SMART Domains Protein: ENSMUSP00000100093
Gene: ENSMUSG00000076476

DomainStartEndE-ValueType
Pfam:V-set 15 111 8e-11 PFAM
Pfam:I-set 17 111 1.8e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Trbv20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Trbv20 APN 6 41188307 splice site probably benign
IGL02451:Trbv20 APN 6 41188276 missense unknown
IGL03161:Trbv20 APN 6 41188823 missense probably benign 0.44
R5789:Trbv20 UTSW 6 41188791 missense probably damaging 1.00
R6245:Trbv20 UTSW 6 41188906 missense possibly damaging 0.87
R7556:Trbv20 UTSW 6 41188781 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGATTCTGAGGCTACTTGAGG -3'
(R):5'- CCTTCACTTTCCGTGGATGGTG -3'

Sequencing Primer
(F):5'- GAGGCATGTATGTTTCTTCAAGAC -3'
(R):5'- AGATGTGCCATCTCATCTGATCAG -3'
Posted On2015-05-15