Mutagenetix > Incidental Mutation

Incidental Mutation 'R4060:Mast3'

315821

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

041618-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4060 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70781194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 969 (V969A)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: V985A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V985A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: V969A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.4779

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (41/43)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Abca8b	A	T	11: 109,957,201	M756K	probably benign	Het
Cd44	T	C	2: 102,901,342	D2G	probably damaging	Het
Cdan1	T	C	2: 120,725,743	I681V	probably benign	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Cfh	T	C	1: 140,119,926	I488M	possibly damaging	Het
Cntn2	T	A	1: 132,525,896	L346F	probably damaging	Het
Creb3l2	T	C	6: 37,334,549	H435R	probably benign	Het
Dmbt1	A	G	7: 131,074,202		probably benign	Het
Fam162a	C	T	16: 36,044,081	R38K	probably benign	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Foxo1	A	G	3: 52,345,162	R249G	probably damaging	Het
Grm6	A	G	11: 50,853,224	E174G	probably damaging	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hypk	A	G	2: 121,453,679		probably benign	Het
Ifih1	T	C	2: 62,598,799	T932A	possibly damaging	Het
Igfbp1	C	A	11: 7,198,091	P45T	probably damaging	Het
Ik	A	G	18: 36,748,890	K142E	probably damaging	Het
Ltbp3	T	C	19: 5,742,320	L27P	probably benign	Het
Mrps24	G	A	11: 5,704,676	R93*	probably null	Het
Olfr342	A	G	2: 36,527,414	M1V	probably null	Het
Olfr53	T	C	7: 140,652,120	I47T	probably damaging	Het
Olfr832	T	C	9: 18,945,050	V134A	probably benign	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pcdhb20	A	G	18: 37,506,164	E581G	probably damaging	Het
Rnf146	T	C	10: 29,347,367	I174M	probably damaging	Het
Serpinb9g	G	A	13: 33,495,106	V320I	probably benign	Het
Sh3pxd2b	G	T	11: 32,422,263	A477S	probably benign	Het
Slc23a3	T	G	1: 75,133,320		probably benign	Het
Ssrp1	T	G	2: 85,041,634	Y401D	probably damaging	Het
Tas2r109	A	T	6: 132,980,185	W261R	probably damaging	Het
Tas2r144	T	C	6: 42,215,629	V101A	possibly damaging	Het
Tead1	T	A	7: 112,876,062		probably null	Het
Tiam2	A	G	17: 3,428,980	S663G	probably benign	Het
Trbv20	T	G	6: 41,188,261		probably benign	Het
Tspan9	T	C	6: 128,034,172	I19M	probably benign	Het
Ttbk2	T	A	2: 120,748,984	E552D	probably benign	Het
Zfp292	A	G	4: 34,810,863	V727A	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCACCACGTCCATGTGTAC -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- AGGACTGACTCCCCATTGATGTG -3'
(R):5'- TCTACAGACGACGGCAGC -3'

Posted On

2015-05-15