Incidental Mutation 'R4060:Mast3'
ID 315821
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 041618-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4060 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71233838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 969 (V969A)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: V985A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V985A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: V969A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Meta Mutation Damage Score 0.4779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,197,928 (GRCm39) L140Q probably damaging Het
Abca8b A T 11: 109,848,027 (GRCm39) M756K probably benign Het
Cd44 T C 2: 102,731,687 (GRCm39) D2G probably damaging Het
Cdan1 T C 2: 120,556,224 (GRCm39) I681V probably benign Het
Cdc5l C T 17: 45,721,816 (GRCm39) A485T probably benign Het
Cfh T C 1: 140,047,664 (GRCm39) I488M possibly damaging Het
Cntn2 T A 1: 132,453,634 (GRCm39) L346F probably damaging Het
Creb3l2 T C 6: 37,311,484 (GRCm39) H435R probably benign Het
Dmbt1 A G 7: 130,675,932 (GRCm39) probably benign Het
Fam162a C T 16: 35,864,451 (GRCm39) R38K probably benign Het
Fat1 A T 8: 45,478,518 (GRCm39) E2521D probably benign Het
Foxo1 A G 3: 52,252,583 (GRCm39) R249G probably damaging Het
Grm6 A G 11: 50,744,051 (GRCm39) E174G probably damaging Het
Gtpbp2 G A 17: 46,478,253 (GRCm39) R467H probably damaging Het
Hypk A G 2: 121,284,160 (GRCm39) probably benign Het
Ifih1 T C 2: 62,429,143 (GRCm39) T932A possibly damaging Het
Igfbp1 C A 11: 7,148,091 (GRCm39) P45T probably damaging Het
Ik A G 18: 36,881,943 (GRCm39) K142E probably damaging Het
Ltbp3 T C 19: 5,792,348 (GRCm39) L27P probably benign Het
Mrps24 G A 11: 5,654,676 (GRCm39) R93* probably null Het
Or13a20 T C 7: 140,232,033 (GRCm39) I47T probably damaging Het
Or1j14 A G 2: 36,417,426 (GRCm39) M1V probably null Het
Or7g19 T C 9: 18,856,346 (GRCm39) V134A probably benign Het
Otop2 G A 11: 115,220,201 (GRCm39) G347D probably damaging Het
Pcdhb20 A G 18: 37,639,217 (GRCm39) E581G probably damaging Het
Rnf146 T C 10: 29,223,363 (GRCm39) I174M probably damaging Het
Serpinb9g G A 13: 33,679,089 (GRCm39) V320I probably benign Het
Sh3pxd2b G T 11: 32,372,263 (GRCm39) A477S probably benign Het
Slc23a3 T G 1: 75,109,964 (GRCm39) probably benign Het
Ssrp1 T G 2: 84,871,978 (GRCm39) Y401D probably damaging Het
Tas2r109 A T 6: 132,957,148 (GRCm39) W261R probably damaging Het
Tas2r144 T C 6: 42,192,563 (GRCm39) V101A possibly damaging Het
Tead1 T A 7: 112,475,269 (GRCm39) probably null Het
Tiam2 A G 17: 3,479,255 (GRCm39) S663G probably benign Het
Trbv20 T G 6: 41,165,195 (GRCm39) probably benign Het
Tspan9 T C 6: 128,011,135 (GRCm39) I19M probably benign Het
Ttbk2 T A 2: 120,579,465 (GRCm39) E552D probably benign Het
Zfp292 A G 4: 34,810,863 (GRCm39) V727A probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCACCACGTCCATGTGTAC -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- AGGACTGACTCCCCATTGATGTG -3'
(R):5'- TCTACAGACGACGGCAGC -3'
Posted On 2015-05-15