Incidental Mutation 'R4060:Mrps24'
ID315824
Institutional Source Beutler Lab
Gene Symbol Mrps24
Ensembl Gene ENSMUSG00000020477
Gene Namemitochondrial ribosomal protein S24
Synonyms3110030K20Rik, Rpms24
MMRRC Submission 041618-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5703983-5715680 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 5704676 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 93 (R93*)
Ref Sequence ENSEMBL: ENSMUSP00000119535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000154330]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149980
Predicted Effect probably null
Transcript: ENSMUST00000154330
AA Change: R93*
SMART Domains Protein: ENSMUSP00000119535
Gene: ENSMUSG00000020477
AA Change: R93*

DomainStartEndE-ValueType
Pfam:MRP-S24 36 167 1.1e-61 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 11. Read-through transcription exists between this gene and the upstream upregulator of cell proliferation (URGCP) gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Mrps24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0791:Mrps24 UTSW 11 5704684 missense possibly damaging 0.72
R4062:Mrps24 UTSW 11 5704676 nonsense probably null
R4064:Mrps24 UTSW 11 5704676 nonsense probably null
R5963:Mrps24 UTSW 11 5707481 splice site probably benign
R6598:Mrps24 UTSW 11 5704713 missense probably benign 0.00
R6974:Mrps24 UTSW 11 5704663 missense probably benign 0.00
Z1176:Mrps24 UTSW 11 5704538 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTACTTGTACACGACCTTGGAGG -3'
(R):5'- ATCCCTGCGCTTTGGATTTTAG -3'

Sequencing Primer
(F):5'- AGTCGCACAGGACACTTG -3'
(R):5'- AGAATGTTTTCCTATTCCGTTAGCG -3'
Posted On2015-05-15