Incidental Mutation 'R4060:Sh3pxd2b'
ID315826
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene NameSH3 and PX domains 2B
SynonymsG431001E03Rik, Fad49, Tsk4
MMRRC Submission 041618-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location32347820-32428173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32422263 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 477 (A477S)
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
Predicted Effect probably benign
Transcript: ENSMUST00000038753
AA Change: A477S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: A477S

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32403993 nonsense probably null
IGL01581:Sh3pxd2b APN 11 32387973 missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32423095 missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32387992 missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32417161 missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32411448 splice site probably benign
IGL03378:Sh3pxd2b APN 11 32381443 missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423064 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423060 small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32423023 missense possibly damaging 0.77
R0715:Sh3pxd2b UTSW 11 32423341 missense possibly damaging 0.93
R1456:Sh3pxd2b UTSW 11 32415967 missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32381441 missense possibly damaging 0.90
R1748:Sh3pxd2b UTSW 11 32422203 missense possibly damaging 0.92
R1902:Sh3pxd2b UTSW 11 32423559 makesense probably null
R1977:Sh3pxd2b UTSW 11 32422138 missense probably damaging 1.00
R3761:Sh3pxd2b UTSW 11 32422750 missense probably benign 0.45
R3850:Sh3pxd2b UTSW 11 32411505 missense probably damaging 1.00
R4062:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32396479 missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32381447 missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32422812 missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32422422 missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32407570 missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32422985 missense probably benign 0.30
R6392:Sh3pxd2b UTSW 11 32423302 missense possibly damaging 0.74
R6625:Sh3pxd2b UTSW 11 32422594 missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32415978 splice site probably null
R7056:Sh3pxd2b UTSW 11 32422737 missense probably benign 0.01
R7131:Sh3pxd2b UTSW 11 32422072 missense probably damaging 1.00
R7192:Sh3pxd2b UTSW 11 32414318 missense probably damaging 1.00
R7911:Sh3pxd2b UTSW 11 32371533 missense probably damaging 1.00
R8026:Sh3pxd2b UTSW 11 32411567 missense probably damaging 1.00
R8027:Sh3pxd2b UTSW 11 32422210 missense probably benign 0.01
RF016:Sh3pxd2b UTSW 11 32423053 small insertion probably benign
RF022:Sh3pxd2b UTSW 11 32423054 small insertion probably benign
RF025:Sh3pxd2b UTSW 11 32423057 small insertion probably benign
RF040:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF056:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF063:Sh3pxd2b UTSW 11 32423051 small insertion probably benign
X0017:Sh3pxd2b UTSW 11 32414359 missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32423110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGCGACCTTCATTGACAAG -3'
(R):5'- GCTTTGCTGGAATCATTGGC -3'

Sequencing Primer
(F):5'- CAGCGACCTTCATTGACAAGTATAAG -3'
(R):5'- GCTGGAATCATTGGCAATATCATGC -3'
Posted On2015-05-15