Incidental Mutation 'R4060:Cdc5l'
ID315833
Institutional Source Beutler Lab
Gene Symbol Cdc5l
Ensembl Gene ENSMUSG00000023932
Gene Namecell division cycle 5-like (S. pombe)
SynonymsPCDC5RP, 1200002I02Rik
MMRRC Submission 041618-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location45391892-45433707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45410890 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 485 (A485T)
Ref Sequence ENSEMBL: ENSMUSP00000024727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024727]
Predicted Effect probably benign
Transcript: ENSMUST00000024727
AA Change: A485T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024727
Gene: ENSMUSG00000023932
AA Change: A485T

DomainStartEndE-ValueType
SANT 7 56 4.41e-15 SMART
SANT 59 106 6.29e-11 SMART
coiled coil region 150 181 N/A INTRINSIC
Blast:SANT 187 233 5e-23 BLAST
low complexity region 258 271 N/A INTRINSIC
Pfam:Myb_Cef 404 655 3.1e-85 PFAM
low complexity region 706 718 N/A INTRINSIC
coiled coil region 764 802 N/A INTRINSIC
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Cdc5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Cdc5l APN 17 45404676 missense probably damaging 0.98
IGL01629:Cdc5l APN 17 45413190 missense probably benign 0.26
IGL02596:Cdc5l APN 17 45424604 splice site probably benign
IGL02973:Cdc5l APN 17 45404647 missense probably benign 0.31
IGL03102:Cdc5l APN 17 45407931 missense probably damaging 0.99
IGL03113:Cdc5l APN 17 45433422 missense possibly damaging 0.47
R0255:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0333:Cdc5l UTSW 17 45393216 splice site probably benign
R0432:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0532:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0551:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0839:Cdc5l UTSW 17 45393147 missense probably benign 0.10
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1483:Cdc5l UTSW 17 45408364 missense possibly damaging 0.79
R1634:Cdc5l UTSW 17 45404706 missense probably damaging 0.99
R1751:Cdc5l UTSW 17 45407805 missense probably benign
R1954:Cdc5l UTSW 17 45426516 splice site probably null
R1955:Cdc5l UTSW 17 45426516 splice site probably null
R2197:Cdc5l UTSW 17 45407819 missense probably benign 0.00
R2229:Cdc5l UTSW 17 45407846 missense probably benign 0.04
R4061:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4064:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4172:Cdc5l UTSW 17 45419772 missense probably damaging 1.00
R4334:Cdc5l UTSW 17 45410786 missense probably benign 0.00
R5093:Cdc5l UTSW 17 45393041 missense possibly damaging 0.50
R5268:Cdc5l UTSW 17 45415585 missense probably damaging 0.99
R5729:Cdc5l UTSW 17 45426569 missense probably benign 0.39
R6190:Cdc5l UTSW 17 45408017 missense probably benign 0.08
R6462:Cdc5l UTSW 17 45393049 missense probably benign
R6540:Cdc5l UTSW 17 45426644 missense probably damaging 1.00
R7232:Cdc5l UTSW 17 45427937 critical splice donor site probably null
R7381:Cdc5l UTSW 17 45411923 missense probably benign 0.00
R7589:Cdc5l UTSW 17 45410781 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGCCGCATGACCATACTGAC -3'
(R):5'- TTGAGGATCACTTTACAAGAGTCAC -3'

Sequencing Primer
(F):5'- GACCATACTGACCATACTGATGATG -3'
(R):5'- TTTGGGTCAGAGCACACCTTACAG -3'
Posted On2015-05-15