Incidental Mutation 'R4060:Gtpbp2'
ID315834
Institutional Source Beutler Lab
Gene Symbol Gtpbp2
Ensembl Gene ENSMUSG00000023952
Gene NameGTP binding protein 2
Synonyms
MMRRC Submission 041618-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46161032-46169370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46167327 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 467 (R467H)
Ref Sequence ENSEMBL: ENSMUSP00000024748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024748] [ENSMUST00000024749] [ENSMUST00000166563] [ENSMUST00000169383] [ENSMUST00000172170]
Predicted Effect probably damaging
Transcript: ENSMUST00000024748
AA Change: R467H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024748
Gene: ENSMUSG00000023952
AA Change: R467H

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 412 4.2e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:GTP_EFTU_D3 499 589 8.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024749
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164338
Predicted Effect probably benign
Transcript: ENSMUST00000166252
Predicted Effect probably benign
Transcript: ENSMUST00000166563
SMART Domains Protein: ENSMUSP00000127896
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166663
Predicted Effect unknown
Transcript: ENSMUST00000166701
AA Change: R32H
SMART Domains Protein: ENSMUSP00000131772
Gene: ENSMUSG00000023952
AA Change: R32H

DomainStartEndE-ValueType
SCOP:d1f60a2 69 111 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167681
Predicted Effect probably benign
Transcript: ENSMUST00000169383
SMART Domains Protein: ENSMUSP00000133050
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171901
Predicted Effect probably damaging
Transcript: ENSMUST00000172170
AA Change: R467H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128517
Gene: ENSMUSG00000023952
AA Change: R467H

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 411 9.4e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Meta Mutation Damage Score 0.1751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins, or G proteins, constitute a superfamily capable of binding GTP or GDP. G proteins are activated by binding GTP and are inactivated by hydrolyzing GTP to GDP. This general mechanism enables G proteins to perform a wide range of biologic activities.[supplied by OMIM, Jan 2003]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Gtpbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Gtpbp2 APN 17 46168254 missense probably damaging 1.00
IGL01534:Gtpbp2 APN 17 46163504 missense probably damaging 1.00
IGL02272:Gtpbp2 APN 17 46164781 missense probably benign 0.00
IGL02864:Gtpbp2 APN 17 46165594 missense probably benign 0.00
R0894:Gtpbp2 UTSW 17 46165969 missense possibly damaging 0.85
R1575:Gtpbp2 UTSW 17 46165943 missense probably damaging 1.00
R1632:Gtpbp2 UTSW 17 46168592 missense probably benign
R1639:Gtpbp2 UTSW 17 46165771 splice site probably null
R1786:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2132:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2133:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2223:Gtpbp2 UTSW 17 46167227 missense probably benign
R3742:Gtpbp2 UTSW 17 46165882 missense probably benign 0.03
R4061:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4064:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4387:Gtpbp2 UTSW 17 46166358 missense probably benign 0.03
R4469:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R4583:Gtpbp2 UTSW 17 46161145 missense probably damaging 0.99
R4664:Gtpbp2 UTSW 17 46161154 missense probably benign 0.33
R4724:Gtpbp2 UTSW 17 46167221 critical splice acceptor site probably null
R5338:Gtpbp2 UTSW 17 46167834 missense probably damaging 1.00
R5368:Gtpbp2 UTSW 17 46166304 splice site probably benign
R5832:Gtpbp2 UTSW 17 46167862 missense probably damaging 0.98
R6490:Gtpbp2 UTSW 17 46168221 missense probably benign 0.01
R6526:Gtpbp2 UTSW 17 46164111 intron probably null
R6723:Gtpbp2 UTSW 17 46168276 missense probably benign 0.05
R6860:Gtpbp2 UTSW 17 46167988 intron probably benign
R7336:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R7662:Gtpbp2 UTSW 17 46166435 missense probably benign 0.00
R7710:Gtpbp2 UTSW 17 46167787 missense possibly damaging 0.92
R8021:Gtpbp2 UTSW 17 46164269 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTGACCTTGGCAAAGAAGTC -3'
(R):5'- GCATCCTACGCTCTTTCAGTAG -3'

Sequencing Primer
(F):5'- TCAGAGGGAGCTATGCTGACAC -3'
(R):5'- TCAGTAGTCTATATAGCCAGGCC -3'
Posted On2015-05-15