Mutagenetix > Incidental Mutations

Incidental Mutation 'R4061:Iars2'

315844

Institutional Source

Beutler Lab

Gene Symbol

Iars2

Ensembl Gene

ENSMUSG00000026618

Gene Name

isoleucine-tRNA synthetase 2, mitochondrial

Synonyms

2010002H18Rik

MMRRC Submission

040852-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

185284726-185329396 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 185303386 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 552 (H552Q)

Ref Sequence

ENSEMBL: ENSMUSP00000106603 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000110975]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027921
AA Change: H552Q

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: H552Q

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
Pfam:tRNA-synt_1	87	712	3.6e-172	PFAM
Pfam:tRNA-synt_1g	112	268	7e-15	PFAM
Pfam:tRNA-synt_1_2	334	462	3.8e-7	PFAM
Pfam:Anticodon_1	756	920	1.3e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110975
AA Change: H552Q

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106603
Gene: ENSMUSG00000026618
AA Change: H552Q

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
Pfam:tRNA-synt_1	87	712	1.2e-171	PFAM
Pfam:tRNA-synt_1g	113	269	3.4e-17	PFAM
Pfam:tRNA-synt_1_2	293	462	1.4e-9	PFAM

Meta Mutation Damage Score

0.2104

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Adam25	A	G	8: 40,753,782	I28M	possibly damaging	Het
Anks1b	A	G	10: 90,307,622	S464G	probably damaging	Het
AU040320	T	A	4: 126,835,695	M550K	probably damaging	Het
Cab39l	A	G	14: 59,499,607	K59E	possibly damaging	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Csmd1	A	G	8: 15,945,158	S2626P	probably benign	Het
Ctss	C	T	3: 95,543,034	R99W	probably benign	Het
Deptor	A	T	15: 55,208,781	M219L	probably benign	Het
Disp1	A	G	1: 183,087,700	V1052A	probably damaging	Het
Esyt3	C	T	9: 99,320,838	S504N	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Folh1	T	A	7: 86,756,962	Y301F	possibly damaging	Het
Gm14443	G	A	2: 175,169,609	T348I	probably benign	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Il18r1	G	A	1: 40,474,936	V101I	probably benign	Het
Impdh2	A	G	9: 108,562,804	R182G	possibly damaging	Het
Krt12	A	T	11: 99,416,015	M487K	unknown	Het
Lmln	C	A	16: 33,066,391	Y89*	probably null	Het
Lrrc38	T	A	4: 143,350,506	L113Q	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Muc5ac	A	G	7: 141,811,130	D1947G	possibly damaging	Het
Myh13	A	T	11: 67,330,889	I177F	possibly damaging	Het
Nfasc	T	C	1: 132,597,845	Y904C	probably damaging	Het
Obscn	G	A	11: 59,008,532	P1000S	probably damaging	Het
Olfr1086	T	A	2: 86,676,818	I172F	probably damaging	Het
Olfr658	T	A	7: 104,644,473	K298*	probably null	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pclo	A	G	5: 14,540,566	E960G	unknown	Het
Plagl1	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	10: 13,128,771		probably benign	Het
Prl7a1	T	C	13: 27,635,849	I141V	possibly damaging	Het
Ptpn18	A	T	1: 34,472,930	H45L	possibly damaging	Het
Sbno1	A	T	5: 124,388,572	M960K	probably damaging	Het
Slx4ip	T	A	2: 137,005,017	S67R	probably benign	Het
Spata18	A	G	5: 73,671,166	K243E	probably damaging	Het
Tcp1	A	G	17: 12,920,863	Q265R	probably benign	Het
Tec	C	T	5: 72,823,409		probably benign	Het
Thbs4	A	G	13: 92,776,097		probably null	Het
Tln1	T	A	4: 43,549,177	Q635L	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Uap1	T	C	1: 170,158,846	E189G	possibly damaging	Het
Usp21	G	A	1: 171,285,401		probably benign	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vmn1r38	A	T	6: 66,776,848	C95S	possibly damaging	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het
Vmn2r84	T	A	10: 130,386,029	E774V	probably damaging	Het

Other mutations in Iars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Iars2	APN	1	185315954	missense	probably benign	0.00
IGL00906:Iars2	APN	1	185296403	splice site	probably benign
IGL01287:Iars2	APN	1	185296428	missense	possibly damaging	0.90
IGL01814:Iars2	APN	1	185302775	nonsense	probably null
IGL02016:Iars2	APN	1	185303306	missense	probably damaging	0.99
IGL02995:Iars2	APN	1	185303301	missense	probably benign
IGL03002:Iars2	APN	1	185322816	splice site	probably null
IGL03248:Iars2	APN	1	185291432	unclassified	probably benign
R0304:Iars2	UTSW	1	185287156	missense	possibly damaging	0.77
R0711:Iars2	UTSW	1	185322388	splice site	probably benign
R0783:Iars2	UTSW	1	185320874	missense	probably damaging	1.00
R0990:Iars2	UTSW	1	185318627	missense	probably damaging	1.00
R1867:Iars2	UTSW	1	185318568	missense	probably benign	0.01
R1868:Iars2	UTSW	1	185318568	missense	probably benign	0.01
R1957:Iars2	UTSW	1	185295671	missense	possibly damaging	0.89
R2378:Iars2	UTSW	1	185327721	missense	probably damaging	1.00
R3784:Iars2	UTSW	1	185287131	missense	probably benign	0.17
R4334:Iars2	UTSW	1	185303394	missense	probably benign	0.35
R4708:Iars2	UTSW	1	185289357	missense	probably benign	0.00
R4723:Iars2	UTSW	1	185315979	missense	probably damaging	1.00
R4729:Iars2	UTSW	1	185316051	missense	possibly damaging	0.71
R4851:Iars2	UTSW	1	185327648	missense	probably damaging	0.99
R5033:Iars2	UTSW	1	185317928	missense	possibly damaging	0.65
R5215:Iars2	UTSW	1	185294769	missense	probably damaging	1.00
R5260:Iars2	UTSW	1	185323734	missense	probably damaging	1.00
R5286:Iars2	UTSW	1	185323121	intron	probably benign
R5614:Iars2	UTSW	1	185289508	missense	probably benign	0.00
R6659:Iars2	UTSW	1	185288076	missense	possibly damaging	0.76
R6838:Iars2	UTSW	1	185329145	missense	probably damaging	0.98
R7057:Iars2	UTSW	1	185289367	missense	probably benign	0.03
R7462:Iars2	UTSW	1	185322866	missense	probably damaging	1.00
R7690:Iars2	UTSW	1	185320997	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCACTGCTATGCTACAGAGG -3'
(R):5'- TGTTTACCACTTAGAACACAGCTGTC -3'

Sequencing Primer
(F):5'- CTACAGAGGATGTTTTGACTGCAAG -3'
(R):5'- GCTGTCAGCGCCATCTTATAATG -3'

Posted On

2015-05-15