Incidental Mutation 'R4061:Lrrc38'
ID315851
Institutional Source Beutler Lab
Gene Symbol Lrrc38
Ensembl Gene ENSMUSG00000028584
Gene Nameleucine rich repeat containing 38
Synonyms
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143349757-143371032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143350506 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 113 (L113Q)
Ref Sequence ENSEMBL: ENSMUSP00000053597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052458]
Predicted Effect probably damaging
Transcript: ENSMUST00000052458
AA Change: L113Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053597
Gene: ENSMUSG00000028584
AA Change: L113Q

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
LRRNT 31 64 2.82e-4 SMART
LRR 84 106 1.37e1 SMART
LRR 108 130 5.26e0 SMART
LRR 132 154 2.27e1 SMART
LRR 155 178 8.09e-1 SMART
LRRCT 190 244 8.63e-6 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Lrrc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Lrrc38 UTSW 4 143350409 missense probably damaging 0.99
R0545:Lrrc38 UTSW 4 143350758 missense probably benign 0.41
R1078:Lrrc38 UTSW 4 143350518 missense probably benign 0.06
R1467:Lrrc38 UTSW 4 143369880 missense probably damaging 1.00
R1467:Lrrc38 UTSW 4 143369880 missense probably damaging 1.00
R1967:Lrrc38 UTSW 4 143369983 missense unknown
R2221:Lrrc38 UTSW 4 143369849 nonsense probably null
R2223:Lrrc38 UTSW 4 143369849 nonsense probably null
R4930:Lrrc38 UTSW 4 143369868 missense probably damaging 0.98
R5585:Lrrc38 UTSW 4 143350391 missense probably damaging 0.96
R6787:Lrrc38 UTSW 4 143369794 missense probably benign 0.18
R7046:Lrrc38 UTSW 4 143350169 start codon destroyed probably null
R7706:Lrrc38 UTSW 4 143350275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCCTCTTGGTGCTGCTC -3'
(R):5'- ATCCAAAGCCGCCACGTTG -3'

Sequencing Primer
(F):5'- ATACCGTGGACTGTCGCGATC -3'
(R):5'- ACGTTGAGGCTGCGCAG -3'
Posted On2015-05-15