Incidental Mutation 'R4061:Vmn2r12'
ID315855
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Namevomeronasal 2, receptor 12
SynonymsGm6769
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109085849-109097864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109092192 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 168 (N168K)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095922
AA Change: N168K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: N168K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109097675 missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109086259 missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109091850 missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109093027 nonsense probably null
IGL01762:Vmn2r12 APN 5 109086564 missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109092159 missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109086477 missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109085992 missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109090485 missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109092070 missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109092899 missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109091889 nonsense probably null
R0529:Vmn2r12 UTSW 5 109092848 missense probably benign
R0715:Vmn2r12 UTSW 5 109090507 missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109086415 missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109087850 critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109091897 missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109086586 missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109092974 missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109092830 missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109092044 missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109091728 missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109092076 missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109091474 missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109090504 missense probably benign 0.02
R4063:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109091546 missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109086435 missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109086513 missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109092986 missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109091678 missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109091506 missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109090395 missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109091818 missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109086617 nonsense probably null
R5639:Vmn2r12 UTSW 5 109092800 missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109091804 missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109085870 nonsense probably null
R6142:Vmn2r12 UTSW 5 109092897 missense probably benign
R6162:Vmn2r12 UTSW 5 109086564 missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109086000 missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109092905 missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109097789 missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109086247 missense possibly damaging 0.74
R7341:Vmn2r12 UTSW 5 109091945 missense possibly damaging 0.95
R7383:Vmn2r12 UTSW 5 109092818 missense probably benign 0.19
Z1088:Vmn2r12 UTSW 5 109092780 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTAAACAGATTCCATGTCCTTG -3'
(R):5'- GGCAAACTGTCAAGAATACTCTAG -3'

Sequencing Primer
(F):5'- AAACAGATTCCATGTCCTTGCATTTC -3'
(R):5'- ACCTGTGTATCAGTCCAAAT -3'
Posted On2015-05-15