Mutagenetix > Incidental Mutation

Incidental Mutation 'R4061:Vmn2r12'

315855

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r12

Ensembl Gene

ENSMUSG00000090688

Gene Name

vomeronasal 2, receptor 12

Synonyms

Gm6769

MMRRC Submission

040852-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R4061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109085849-109097864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109092192 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 168 (N168K)

Ref Sequence

ENSEMBL: ENSMUSP00000093612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095922]

AlphaFold

L7N217

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095922
AA Change: N168K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: N168K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	76	466	8.8e-30	PFAM
Pfam:NCD3G	505	559	1.7e-18	PFAM
Pfam:7tm_3	591	827	3.9e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (51/54)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Adam25	A	G	8: 40,753,782	I28M	possibly damaging	Het
Anks1b	A	G	10: 90,307,622	S464G	probably damaging	Het
AU040320	T	A	4: 126,835,695	M550K	probably damaging	Het
Cab39l	A	G	14: 59,499,607	K59E	possibly damaging	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Csmd1	A	G	8: 15,945,158	S2626P	probably benign	Het
Ctss	C	T	3: 95,543,034	R99W	probably benign	Het
Deptor	A	T	15: 55,208,781	M219L	probably benign	Het
Disp1	A	G	1: 183,087,700	V1052A	probably damaging	Het
Esyt3	C	T	9: 99,320,838	S504N	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Folh1	T	A	7: 86,756,962	Y301F	possibly damaging	Het
Gm14443	G	A	2: 175,169,609	T348I	probably benign	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Iars2	A	T	1: 185,303,386	H552Q	possibly damaging	Het
Il18r1	G	A	1: 40,474,936	V101I	probably benign	Het
Impdh2	A	G	9: 108,562,804	R182G	possibly damaging	Het
Krt12	A	T	11: 99,416,015	M487K	unknown	Het
Lmln	C	A	16: 33,066,391	Y89*	probably null	Het
Lrrc38	T	A	4: 143,350,506	L113Q	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Muc5ac	A	G	7: 141,811,130	D1947G	possibly damaging	Het
Myh13	A	T	11: 67,330,889	I177F	possibly damaging	Het
Nfasc	T	C	1: 132,597,845	Y904C	probably damaging	Het
Obscn	G	A	11: 59,008,532	P1000S	probably damaging	Het
Olfr1086	T	A	2: 86,676,818	I172F	probably damaging	Het
Olfr658	T	A	7: 104,644,473	K298*	probably null	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pclo	A	G	5: 14,540,566	E960G	unknown	Het
Plagl1	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	10: 13,128,771		probably benign	Het
Prl7a1	T	C	13: 27,635,849	I141V	possibly damaging	Het
Ptpn18	A	T	1: 34,472,930	H45L	possibly damaging	Het
Sbno1	A	T	5: 124,388,572	M960K	probably damaging	Het
Slx4ip	T	A	2: 137,005,017	S67R	probably benign	Het
Spata18	A	G	5: 73,671,166	K243E	probably damaging	Het
Tcp1	A	G	17: 12,920,863	Q265R	probably benign	Het
Tec	C	T	5: 72,823,409		probably benign	Het
Thbs4	A	G	13: 92,776,097		probably null	Het
Tln1	T	A	4: 43,549,177	Q635L	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Uap1	T	C	1: 170,158,846	E189G	possibly damaging	Het
Usp21	G	A	1: 171,285,401		probably benign	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vmn1r38	A	T	6: 66,776,848	C95S	possibly damaging	Het
Vmn2r84	T	A	10: 130,386,029	E774V	probably damaging	Het

Other mutations in Vmn2r12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Vmn2r12	APN	5	109097675	missense	possibly damaging	0.47
IGL01096:Vmn2r12	APN	5	109086259	missense	probably damaging	1.00
IGL01538:Vmn2r12	APN	5	109091850	missense	probably damaging	1.00
IGL01548:Vmn2r12	APN	5	109093027	nonsense	probably null
IGL01762:Vmn2r12	APN	5	109086564	missense	probably damaging	0.99
IGL01860:Vmn2r12	APN	5	109092159	missense	probably benign	0.10
IGL02269:Vmn2r12	APN	5	109086477	missense	probably damaging	1.00
IGL02530:Vmn2r12	APN	5	109085992	missense	probably damaging	1.00
IGL02887:Vmn2r12	APN	5	109090485	missense	probably benign	0.03
IGL03265:Vmn2r12	APN	5	109092070	missense	probably benign	0.05
R0396:Vmn2r12	UTSW	5	109092899	missense	probably benign	0.00
R0497:Vmn2r12	UTSW	5	109091889	nonsense	probably null
R0529:Vmn2r12	UTSW	5	109092848	missense	probably benign
R0715:Vmn2r12	UTSW	5	109090507	missense	probably benign	0.10
R0742:Vmn2r12	UTSW	5	109086415	missense	possibly damaging	0.55
R0894:Vmn2r12	UTSW	5	109087850	critical splice donor site	probably null
R1173:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1174:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1259:Vmn2r12	UTSW	5	109091897	missense	probably damaging	0.97
R1349:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R1388:Vmn2r12	UTSW	5	109092974	missense	possibly damaging	0.56
R1549:Vmn2r12	UTSW	5	109092830	missense	probably benign	0.06
R1766:Vmn2r12	UTSW	5	109092044	missense	probably damaging	1.00
R1781:Vmn2r12	UTSW	5	109091728	missense	probably benign	0.00
R1885:Vmn2r12	UTSW	5	109092076	missense	probably damaging	1.00
R2159:Vmn2r12	UTSW	5	109091474	missense	probably benign	0.02
R2420:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2421:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2422:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2937:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R2938:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R3898:Vmn2r12	UTSW	5	109090504	missense	probably benign	0.02
R4063:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4090:Vmn2r12	UTSW	5	109091546	missense	probably benign	0.06
R4297:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4298:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4299:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4304:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4306:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4307:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4308:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4594:Vmn2r12	UTSW	5	109086435	missense	probably damaging	1.00
R4783:Vmn2r12	UTSW	5	109086513	missense	probably damaging	1.00
R4900:Vmn2r12	UTSW	5	109092986	missense	probably damaging	1.00
R4929:Vmn2r12	UTSW	5	109091678	missense	probably damaging	1.00
R4974:Vmn2r12	UTSW	5	109091506	missense	probably damaging	1.00
R5389:Vmn2r12	UTSW	5	109090395	missense	probably benign	0.00
R5431:Vmn2r12	UTSW	5	109091818	missense	probably damaging	0.99
R5527:Vmn2r12	UTSW	5	109086617	nonsense	probably null
R5639:Vmn2r12	UTSW	5	109092800	missense	probably benign	0.06
R5753:Vmn2r12	UTSW	5	109091804	missense	probably damaging	1.00
R5797:Vmn2r12	UTSW	5	109085870	nonsense	probably null
R6142:Vmn2r12	UTSW	5	109092897	missense	probably benign
R6162:Vmn2r12	UTSW	5	109086564	missense	probably damaging	0.99
R6176:Vmn2r12	UTSW	5	109086000	missense	probably benign	0.43
R6853:Vmn2r12	UTSW	5	109092905	missense	probably damaging	1.00
R7238:Vmn2r12	UTSW	5	109097789	missense	possibly damaging	0.81
R7341:Vmn2r12	UTSW	5	109086247	missense	possibly damaging	0.74
R7341:Vmn2r12	UTSW	5	109091945	missense	possibly damaging	0.95
R7383:Vmn2r12	UTSW	5	109092818	missense	probably benign	0.19
R7740:Vmn2r12	UTSW	5	109091749	missense	probably damaging	1.00
R7749:Vmn2r12	UTSW	5	109086054	missense	probably damaging	0.99
R7861:Vmn2r12	UTSW	5	109087963	missense	probably benign	0.00
R7908:Vmn2r12	UTSW	5	109086441	missense	probably damaging	1.00
R8128:Vmn2r12	UTSW	5	109091881	missense	possibly damaging	0.81
R8175:Vmn2r12	UTSW	5	109090483	missense	probably damaging	0.97
R8234:Vmn2r12	UTSW	5	109086208	missense	probably benign	0.01
R8771:Vmn2r12	UTSW	5	109092086	missense	possibly damaging	0.95
R8947:Vmn2r12	UTSW	5	109086656	missense	possibly damaging	0.64
R8991:Vmn2r12	UTSW	5	109086167	nonsense	probably null
R9116:Vmn2r12	UTSW	5	109086019	missense	probably damaging	1.00
R9122:Vmn2r12	UTSW	5	109093044	missense	probably benign	0.00
R9153:Vmn2r12	UTSW	5	109086337	missense	probably damaging	1.00
R9371:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R9375:Vmn2r12	UTSW	5	109086120	missense	probably damaging	1.00
R9524:Vmn2r12	UTSW	5	109091957	missense	probably damaging	1.00
R9587:Vmn2r12	UTSW	5	109091456	missense	probably damaging	0.99
Z1088:Vmn2r12	UTSW	5	109092780	missense	probably benign
Z1176:Vmn2r12	UTSW	5	109091437	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCTAAACAGATTCCATGTCCTTG -3'
(R):5'- GGCAAACTGTCAAGAATACTCTAG -3'

Sequencing Primer
(F):5'- AAACAGATTCCATGTCCTTGCATTTC -3'
(R):5'- ACCTGTGTATCAGTCCAAAT -3'

Posted On

2015-05-15