Mutagenetix > Incidental Mutation

Incidental Mutation 'R4061:Sbno1'

315856

Institutional Source

Beutler Lab

Gene Symbol

Sbno1

Ensembl Gene

ENSMUSG00000038095

Gene Name

strawberry notch 1

Synonyms

9330180L10Rik, sno

MMRRC Submission

040852-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124368702-124426001 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124388572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 960 (M960K)

Ref Sequence

ENSEMBL: ENSMUSP00000130860 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000196644] [ENSMUST00000199808] [ENSMUST00000200474]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065263
AA Change: M961K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095
AA Change: M961K

Domain	Start	End	E-Value	Type
low complexity region	217	234	N/A	INTRINSIC
Pfam:AAA_34	254	559	3.6e-144	PFAM
Pfam:ResIII	287	478	2.7e-8	PFAM
low complexity region	633	649	N/A	INTRINSIC
low complexity region	727	748	N/A	INTRINSIC
low complexity region	779	797	N/A	INTRINSIC
low complexity region	815	838	N/A	INTRINSIC
coiled coil region	839	868	N/A	INTRINSIC
Pfam:Helicase_C_4	870	1146	3.6e-126	PFAM
low complexity region	1365	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168651
AA Change: M960K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095
AA Change: M960K

Domain	Start	End	E-Value	Type
low complexity region	217	234	N/A	INTRINSIC
Pfam:AAA_34	254	559	3.6e-144	PFAM
Pfam:ResIII	287	478	2.7e-8	PFAM
low complexity region	633	649	N/A	INTRINSIC
low complexity region	727	748	N/A	INTRINSIC
low complexity region	779	797	N/A	INTRINSIC
low complexity region	815	838	N/A	INTRINSIC
coiled coil region	839	868	N/A	INTRINSIC
Pfam:Helicase_C_4	870	1146	3.6e-126	PFAM
low complexity region	1365	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196644

SMART Domains

Protein: ENSMUSP00000142827
Gene: ENSMUSG00000038095

Domain	Start	End	E-Value	Type
low complexity region	217	234	N/A	INTRINSIC
Pfam:AAA_34	252	560	4.3e-136	PFAM
Pfam:ResIII	289	476	1.8e-6	PFAM
low complexity region	633	649	N/A	INTRINSIC
low complexity region	727	748	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197228

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197723

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199245

Predicted Effect

probably damaging
Transcript: ENSMUST00000199808
AA Change: M961K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095
AA Change: M961K

Domain	Start	End	E-Value	Type
low complexity region	217	234	N/A	INTRINSIC
Pfam:AAA_34	252	560	6e-139	PFAM
Pfam:ResIII	289	476	1.3e-7	PFAM
low complexity region	633	649	N/A	INTRINSIC
low complexity region	727	748	N/A	INTRINSIC
low complexity region	779	797	N/A	INTRINSIC
low complexity region	815	838	N/A	INTRINSIC
coiled coil region	839	868	N/A	INTRINSIC
Pfam:Helicase_C_4	870	1146	4.6e-120	PFAM
low complexity region	1365	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200474

SMART Domains

Protein: ENSMUSP00000143516
Gene: ENSMUSG00000038095

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	181	198	N/A	INTRINSIC
Pfam:AAA_34	218	523	2.3e-141	PFAM
Pfam:ResIII	251	442	3.3e-7	PFAM
low complexity region	597	613	N/A	INTRINSIC
low complexity region	691	712	N/A	INTRINSIC
low complexity region	743	755	N/A	INTRINSIC

Meta Mutation Damage Score

0.5719

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (51/54)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Adam25	A	G	8: 40,753,782	I28M	possibly damaging	Het
Anks1b	A	G	10: 90,307,622	S464G	probably damaging	Het
AU040320	T	A	4: 126,835,695	M550K	probably damaging	Het
Cab39l	A	G	14: 59,499,607	K59E	possibly damaging	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Csmd1	A	G	8: 15,945,158	S2626P	probably benign	Het
Ctss	C	T	3: 95,543,034	R99W	probably benign	Het
Deptor	A	T	15: 55,208,781	M219L	probably benign	Het
Disp1	A	G	1: 183,087,700	V1052A	probably damaging	Het
Esyt3	C	T	9: 99,320,838	S504N	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Folh1	T	A	7: 86,756,962	Y301F	possibly damaging	Het
Gm14443	G	A	2: 175,169,609	T348I	probably benign	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Iars2	A	T	1: 185,303,386	H552Q	possibly damaging	Het
Il18r1	G	A	1: 40,474,936	V101I	probably benign	Het
Impdh2	A	G	9: 108,562,804	R182G	possibly damaging	Het
Krt12	A	T	11: 99,416,015	M487K	unknown	Het
Lmln	C	A	16: 33,066,391	Y89*	probably null	Het
Lrrc38	T	A	4: 143,350,506	L113Q	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Muc5ac	A	G	7: 141,811,130	D1947G	possibly damaging	Het
Myh13	A	T	11: 67,330,889	I177F	possibly damaging	Het
Nfasc	T	C	1: 132,597,845	Y904C	probably damaging	Het
Obscn	G	A	11: 59,008,532	P1000S	probably damaging	Het
Olfr1086	T	A	2: 86,676,818	I172F	probably damaging	Het
Olfr658	T	A	7: 104,644,473	K298*	probably null	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pclo	A	G	5: 14,540,566	E960G	unknown	Het
Plagl1	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	10: 13,128,771		probably benign	Het
Prl7a1	T	C	13: 27,635,849	I141V	possibly damaging	Het
Ptpn18	A	T	1: 34,472,930	H45L	possibly damaging	Het
Slx4ip	T	A	2: 137,005,017	S67R	probably benign	Het
Spata18	A	G	5: 73,671,166	K243E	probably damaging	Het
Tcp1	A	G	17: 12,920,863	Q265R	probably benign	Het
Tec	C	T	5: 72,823,409		probably benign	Het
Thbs4	A	G	13: 92,776,097		probably null	Het
Tln1	T	A	4: 43,549,177	Q635L	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Uap1	T	C	1: 170,158,846	E189G	possibly damaging	Het
Usp21	G	A	1: 171,285,401		probably benign	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vmn1r38	A	T	6: 66,776,848	C95S	possibly damaging	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het
Vmn2r84	T	A	10: 130,386,029	E774V	probably damaging	Het

Other mutations in Sbno1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00563:Sbno1	APN	5	124402205	missense	probably damaging	1.00
IGL01154:Sbno1	APN	5	124410249	missense	probably damaging	1.00
IGL01309:Sbno1	APN	5	124381706	missense	probably benign	0.41
IGL01330:Sbno1	APN	5	124391979	missense	probably damaging	1.00
IGL01541:Sbno1	APN	5	124378555	splice site	probably benign
IGL01800:Sbno1	APN	5	124381505	splice site	probably benign
IGL01987:Sbno1	APN	5	124404219	missense	probably damaging	1.00
IGL02178:Sbno1	APN	5	124400195	splice site	probably null
IGL02544:Sbno1	APN	5	124403983	missense	probably damaging	0.99
IGL02572:Sbno1	APN	5	124381677	splice site	probably benign
IGL02592:Sbno1	APN	5	124400809	missense	probably damaging	1.00
IGL03033:Sbno1	APN	5	124376150	missense	probably damaging	0.97
IGL03089:Sbno1	APN	5	124387311	splice site	probably benign
IGL03131:Sbno1	APN	5	124388605	missense	probably damaging	1.00
Decrement	UTSW	5	124400847	missense	probably damaging	1.00
R0200:Sbno1	UTSW	5	124384541	missense	probably damaging	1.00
R0217:Sbno1	UTSW	5	124404324	critical splice acceptor site	probably null
R0233:Sbno1	UTSW	5	124376226	missense	probably damaging	1.00
R0233:Sbno1	UTSW	5	124376226	missense	probably damaging	1.00
R0334:Sbno1	UTSW	5	124386868	missense	possibly damaging	0.79
R0401:Sbno1	UTSW	5	124410285	missense	probably damaging	0.96
R0608:Sbno1	UTSW	5	124384541	missense	probably damaging	1.00
R0615:Sbno1	UTSW	5	124410139	missense	probably damaging	1.00
R0653:Sbno1	UTSW	5	124386892	missense	possibly damaging	0.79
R0655:Sbno1	UTSW	5	124376149	missense	possibly damaging	0.95
R1037:Sbno1	UTSW	5	124393912	missense	possibly damaging	0.92
R1439:Sbno1	UTSW	5	124384460	splice site	probably benign
R1522:Sbno1	UTSW	5	124392612	missense	probably damaging	1.00
R1590:Sbno1	UTSW	5	124384504	missense	possibly damaging	0.55
R1618:Sbno1	UTSW	5	124404216	missense	probably damaging	1.00
R1671:Sbno1	UTSW	5	124392067	splice site	probably null
R1779:Sbno1	UTSW	5	124388517	unclassified	probably benign
R2103:Sbno1	UTSW	5	124393937	missense	probably damaging	0.98
R2136:Sbno1	UTSW	5	124387534	splice site	probably null
R2149:Sbno1	UTSW	5	124402119	splice site	probably null
R2153:Sbno1	UTSW	5	124378543	missense	probably benign
R2154:Sbno1	UTSW	5	124378511	missense	probably benign
R2231:Sbno1	UTSW	5	124405704	missense	probably damaging	1.00
R2879:Sbno1	UTSW	5	124388572	missense	probably damaging	1.00
R3004:Sbno1	UTSW	5	124381708	missense	probably damaging	0.96
R3922:Sbno1	UTSW	5	124381930	missense	probably damaging	1.00
R4096:Sbno1	UTSW	5	124391920	critical splice donor site	probably null
R4612:Sbno1	UTSW	5	124404024	missense	probably damaging	1.00
R4879:Sbno1	UTSW	5	124404024	missense	probably damaging	1.00
R4937:Sbno1	UTSW	5	124374609	missense	possibly damaging	0.93
R4990:Sbno1	UTSW	5	124400165	missense	probably damaging	1.00
R5341:Sbno1	UTSW	5	124408475	critical splice donor site	probably null
R5365:Sbno1	UTSW	5	124381866	frame shift	probably null
R5399:Sbno1	UTSW	5	124392741	missense	probably benign	0.09
R5704:Sbno1	UTSW	5	124395893	critical splice donor site	probably null
R5898:Sbno1	UTSW	5	124386791	intron	probably benign
R6136:Sbno1	UTSW	5	124378491	missense	probably benign	0.41
R6154:Sbno1	UTSW	5	124378479	missense	possibly damaging	0.94
R6412:Sbno1	UTSW	5	124392714	missense	probably damaging	0.99
R6414:Sbno1	UTSW	5	124395931	missense	probably benign	0.28
R6454:Sbno1	UTSW	5	124400847	missense	probably damaging	1.00
R7085:Sbno1	UTSW	5	124381720	missense	possibly damaging	0.83
R7176:Sbno1	UTSW	5	124392881	missense	probably benign	0.21
R7219:Sbno1	UTSW	5	124405659	missense	probably benign	0.00
R7535:Sbno1	UTSW	5	124413279	missense	possibly damaging	0.48
R7673:Sbno1	UTSW	5	124413216	missense	probably benign
R7692:Sbno1	UTSW	5	124405646	missense	probably benign	0.35
R7745:Sbno1	UTSW	5	124392899	missense	probably benign	0.00
R7762:Sbno1	UTSW	5	124374666	missense	probably benign	0.19
R8012:Sbno1	UTSW	5	124384502	missense	probably benign	0.43
R8142:Sbno1	UTSW	5	124408545	missense	probably benign
R8164:Sbno1	UTSW	5	124374621	missense	probably benign	0.13
R8259:Sbno1	UTSW	5	124381696	missense	probably damaging	0.99
R8289:Sbno1	UTSW	5	124404005	missense	probably damaging	1.00
R8717:Sbno1	UTSW	5	124374555	missense	possibly damaging	0.85
R9045:Sbno1	UTSW	5	124405657	missense	probably benign	0.14
R9149:Sbno1	UTSW	5	124381699	missense	probably benign	0.01
R9529:Sbno1	UTSW	5	124379350	nonsense	probably null
Z1088:Sbno1	UTSW	5	124393958	missense	possibly damaging	0.91
Z1088:Sbno1	UTSW	5	124404304	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCATGCATTGCACATCACAGC -3'
(R):5'- GGCAACATAAGCCCAACTGG -3'

Sequencing Primer
(F):5'- TGCATTGCACATCACAGCATACAG -3'
(R):5'- GGCACTAGGGCATCATATTACTATG -3'

Posted On

2015-05-15