Incidental Mutation 'R4061:Olfr658'
ID315860
Institutional Source Beutler Lab
Gene Symbol Olfr658
Ensembl Gene ENSMUSG00000070421
Gene Nameolfactory receptor 658
SynonymsGA_x6K02T2PBJ9-7273558-7272587, MOR34-5
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104642877-104647305 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 104644473 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 298 (K298*)
Ref Sequence ENSEMBL: ENSMUSP00000147498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089296] [ENSMUST00000210641]
Predicted Effect probably null
Transcript: ENSMUST00000089296
AA Change: K300*
SMART Domains Protein: ENSMUSP00000086711
Gene: ENSMUSG00000070421
AA Change: K300*

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1.9e-108 PFAM
Pfam:7TM_GPCR_Srsx 39 256 3.1e-9 PFAM
Pfam:7tm_1 45 297 1.6e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000210641
AA Change: K298*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Olfr658
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Olfr658 APN 7 104644480 nonsense probably null
IGL01408:Olfr658 APN 7 104644929 missense possibly damaging 0.61
IGL02612:Olfr658 APN 7 104644663 missense probably benign 0.00
R0241:Olfr658 UTSW 7 104645243 missense probably benign 0.00
R0241:Olfr658 UTSW 7 104645243 missense probably benign 0.00
R1171:Olfr658 UTSW 7 104644997 missense probably damaging 1.00
R1465:Olfr658 UTSW 7 104644946 missense probably benign 0.13
R1465:Olfr658 UTSW 7 104644946 missense probably benign 0.13
R1568:Olfr658 UTSW 7 104644770 missense probably benign 0.28
R1866:Olfr658 UTSW 7 104644797 missense probably benign 0.35
R4233:Olfr658 UTSW 7 104644988 missense probably benign 0.15
R6080:Olfr658 UTSW 7 104645310 missense probably benign 0.01
R6479:Olfr658 UTSW 7 104645126 missense probably benign 0.02
R7222:Olfr658 UTSW 7 104644730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGTCTAGATTTTAGTGCCTTG -3'
(R):5'- CATGATTCTGAGGGCAGTGG -3'

Sequencing Primer
(F):5'- CCTTGTTAAGGTAGTGTATGTGCAAG -3'
(R):5'- CAGTGGTCAGCTTATCATCAGCAG -3'
Posted On2015-05-15