Incidental Mutation 'R4061:Adam25'
ID315863
Institutional Source Beutler Lab
Gene Symbol Adam25
Ensembl Gene ENSMUSG00000071937
Gene Namea disintegrin and metallopeptidase domain 25 (testase 2)
Synonymstestase 2
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40752208-40756176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40753782 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 28 (I28M)
Ref Sequence ENSEMBL: ENSMUSP00000094420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096663]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096663
AA Change: I28M

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094420
Gene: ENSMUSG00000071937
AA Change: I28M

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 179 3.4e-21 PFAM
Pfam:Reprolysin_5 220 398 1.6e-16 PFAM
Pfam:Reprolysin_4 220 407 2.5e-13 PFAM
Pfam:Reprolysin 221 410 5.6e-46 PFAM
Pfam:Reprolysin_2 222 399 9.7e-14 PFAM
Pfam:Reprolysin_3 246 366 1e-18 PFAM
DISIN 428 503 3.33e-39 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 706 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210673
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Adam25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Adam25 APN 8 40754921 missense probably benign
IGL01977:Adam25 APN 8 40755097 missense probably benign 0.00
IGL02098:Adam25 APN 8 40755643 missense probably benign 0.12
IGL02233:Adam25 APN 8 40755386 missense probably damaging 1.00
IGL02458:Adam25 APN 8 40753807 missense probably benign 0.01
IGL02527:Adam25 APN 8 40753748 missense possibly damaging 0.78
IGL02632:Adam25 APN 8 40755200 missense possibly damaging 0.90
IGL02995:Adam25 APN 8 40753723 missense probably benign 0.00
H8786:Adam25 UTSW 8 40754224 missense probably benign 0.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0189:Adam25 UTSW 8 40755430 missense probably damaging 1.00
R0505:Adam25 UTSW 8 40755224 missense probably damaging 1.00
R0532:Adam25 UTSW 8 40755950 missense probably benign 0.00
R0699:Adam25 UTSW 8 40755974 missense probably benign
R0972:Adam25 UTSW 8 40755131 missense probably damaging 1.00
R1053:Adam25 UTSW 8 40754731 missense probably benign 0.30
R1079:Adam25 UTSW 8 40755476 missense possibly damaging 0.87
R1872:Adam25 UTSW 8 40755226 nonsense probably null
R1933:Adam25 UTSW 8 40754885 missense probably benign 0.01
R1934:Adam25 UTSW 8 40754885 missense probably benign 0.01
R4702:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4703:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4705:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4859:Adam25 UTSW 8 40754543 missense probably benign 0.01
R5015:Adam25 UTSW 8 40754634 missense probably benign 0.22
R5249:Adam25 UTSW 8 40755954 missense probably benign
R5628:Adam25 UTSW 8 40755710 missense probably benign 0.00
R5791:Adam25 UTSW 8 40754220 missense probably benign
R6439:Adam25 UTSW 8 40754590 missense possibly damaging 0.92
R6693:Adam25 UTSW 8 40754531 missense probably damaging 1.00
R7041:Adam25 UTSW 8 40754084 missense probably benign 0.04
R7101:Adam25 UTSW 8 40755401 missense probably benign 0.00
R7531:Adam25 UTSW 8 40753877 missense probably damaging 0.99
R7600:Adam25 UTSW 8 40755817 missense probably benign 0.01
R7634:Adam25 UTSW 8 40754846 missense probably benign 0.00
RF006:Adam25 UTSW 8 40755797 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTTGAACAAACCTCAGC -3'
(R):5'- TGTGAATAAAATGTTTCTGGCCCC -3'

Sequencing Primer
(F):5'- TGGCCTGCCCATACTGAAATACTC -3'
(R):5'- AATGTTTCTGGCCCCCAAAATG -3'
Posted On2015-05-15