Mutagenetix > Incidental Mutation

Incidental Mutation 'R4061:Mast3'

315865

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

040852-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70781194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 969 (V969A)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: V985A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V985A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: V969A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.4779

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (51/54)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Adam25	A	G	8: 40,753,782	I28M	possibly damaging	Het
Anks1b	A	G	10: 90,307,622	S464G	probably damaging	Het
AU040320	T	A	4: 126,835,695	M550K	probably damaging	Het
Cab39l	A	G	14: 59,499,607	K59E	possibly damaging	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Csmd1	A	G	8: 15,945,158	S2626P	probably benign	Het
Ctss	C	T	3: 95,543,034	R99W	probably benign	Het
Deptor	A	T	15: 55,208,781	M219L	probably benign	Het
Disp1	A	G	1: 183,087,700	V1052A	probably damaging	Het
Esyt3	C	T	9: 99,320,838	S504N	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Folh1	T	A	7: 86,756,962	Y301F	possibly damaging	Het
Gm14443	G	A	2: 175,169,609	T348I	probably benign	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Iars2	A	T	1: 185,303,386	H552Q	possibly damaging	Het
Il18r1	G	A	1: 40,474,936	V101I	probably benign	Het
Impdh2	A	G	9: 108,562,804	R182G	possibly damaging	Het
Krt12	A	T	11: 99,416,015	M487K	unknown	Het
Lmln	C	A	16: 33,066,391	Y89*	probably null	Het
Lrrc38	T	A	4: 143,350,506	L113Q	probably damaging	Het
Muc5ac	A	G	7: 141,811,130	D1947G	possibly damaging	Het
Myh13	A	T	11: 67,330,889	I177F	possibly damaging	Het
Nfasc	T	C	1: 132,597,845	Y904C	probably damaging	Het
Obscn	G	A	11: 59,008,532	P1000S	probably damaging	Het
Olfr1086	T	A	2: 86,676,818	I172F	probably damaging	Het
Olfr658	T	A	7: 104,644,473	K298*	probably null	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pclo	A	G	5: 14,540,566	E960G	unknown	Het
Plagl1	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	10: 13,128,771		probably benign	Het
Prl7a1	T	C	13: 27,635,849	I141V	possibly damaging	Het
Ptpn18	A	T	1: 34,472,930	H45L	possibly damaging	Het
Sbno1	A	T	5: 124,388,572	M960K	probably damaging	Het
Slx4ip	T	A	2: 137,005,017	S67R	probably benign	Het
Spata18	A	G	5: 73,671,166	K243E	probably damaging	Het
Tcp1	A	G	17: 12,920,863	Q265R	probably benign	Het
Tec	C	T	5: 72,823,409		probably benign	Het
Thbs4	A	G	13: 92,776,097		probably null	Het
Tln1	T	A	4: 43,549,177	Q635L	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Uap1	T	C	1: 170,158,846	E189G	possibly damaging	Het
Usp21	G	A	1: 171,285,401		probably benign	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vmn1r38	A	T	6: 66,776,848	C95S	possibly damaging	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het
Vmn2r84	T	A	10: 130,386,029	E774V	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCACCACGTCCATGTGTAC -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- AGGACTGACTCCCCATTGATGTG -3'
(R):5'- TCTACAGACGACGGCAGC -3'

Posted On

2015-05-15