Incidental Mutation 'R4061:Esyt3'
ID 315866
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Name extended synaptotagmin-like protein 3
Synonyms D9Ertd280e, Fam62c
MMRRC Submission 040852-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4061 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 99192016-99240610 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99202891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 504 (S504N)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158] [ENSMUST00000187520]
AlphaFold Q5DTI8
Predicted Effect probably damaging
Transcript: ENSMUST00000042158
AA Change: S504N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: S504N

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186626
Predicted Effect probably damaging
Transcript: ENSMUST00000187520
AA Change: S155N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140567
Gene: ENSMUSG00000037681
AA Change: S155N

DomainStartEndE-ValueType
C2 2 83 5.9e-12 SMART
low complexity region 94 104 N/A INTRINSIC
C2 121 198 2.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191694
Meta Mutation Damage Score 0.2873 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,197,928 (GRCm39) L140Q probably damaging Het
Adam25 A G 8: 41,206,819 (GRCm39) I28M possibly damaging Het
Anks1b A G 10: 90,143,484 (GRCm39) S464G probably damaging Het
AU040320 T A 4: 126,729,488 (GRCm39) M550K probably damaging Het
Cab39l A G 14: 59,737,056 (GRCm39) K59E possibly damaging Het
Cdc5l C T 17: 45,721,816 (GRCm39) A485T probably benign Het
Csmd1 A G 8: 15,995,158 (GRCm39) S2626P probably benign Het
Ctss C T 3: 95,450,345 (GRCm39) R99W probably benign Het
Deptor A T 15: 55,072,177 (GRCm39) M219L probably benign Het
Disp1 A G 1: 182,869,264 (GRCm39) V1052A probably damaging Het
Fat1 A T 8: 45,478,518 (GRCm39) E2521D probably benign Het
Folh1 T A 7: 86,406,170 (GRCm39) Y301F possibly damaging Het
Gm14443 G A 2: 175,011,402 (GRCm39) T348I probably benign Het
Gtpbp2 G A 17: 46,478,253 (GRCm39) R467H probably damaging Het
Hnrnpll T C 17: 80,340,201 (GRCm39) H526R probably benign Het
Iars2 A T 1: 185,035,583 (GRCm39) H552Q possibly damaging Het
Il18r1 G A 1: 40,514,096 (GRCm39) V101I probably benign Het
Impdh2 A G 9: 108,440,003 (GRCm39) R182G possibly damaging Het
Krt12 A T 11: 99,306,841 (GRCm39) M487K unknown Het
Lmln C A 16: 32,886,761 (GRCm39) Y89* probably null Het
Lrrc38 T A 4: 143,077,076 (GRCm39) L113Q probably damaging Het
Mast3 A G 8: 71,233,838 (GRCm39) V969A probably damaging Het
Muc5ac A G 7: 141,364,867 (GRCm39) D1947G possibly damaging Het
Myh13 A T 11: 67,221,715 (GRCm39) I177F possibly damaging Het
Nfasc T C 1: 132,525,583 (GRCm39) Y904C probably damaging Het
Obscn G A 11: 58,899,358 (GRCm39) P1000S probably damaging Het
Or52n4 T A 7: 104,293,680 (GRCm39) K298* probably null Het
Or5t7 T A 2: 86,507,162 (GRCm39) I172F probably damaging Het
Otop2 G A 11: 115,220,201 (GRCm39) G347D probably damaging Het
Pclo A G 5: 14,590,580 (GRCm39) E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,004,515 (GRCm39) probably benign Het
Prl7a1 T C 13: 27,819,832 (GRCm39) I141V possibly damaging Het
Ptpn18 A T 1: 34,512,011 (GRCm39) H45L possibly damaging Het
Sbno1 A T 5: 124,526,635 (GRCm39) M960K probably damaging Het
Slx4ip T A 2: 136,846,937 (GRCm39) S67R probably benign Het
Spata18 A G 5: 73,828,509 (GRCm39) K243E probably damaging Het
Tcp1 A G 17: 13,139,750 (GRCm39) Q265R probably benign Het
Tec C T 5: 72,980,752 (GRCm39) probably benign Het
Thbs4 A G 13: 92,912,605 (GRCm39) probably null Het
Tln1 T A 4: 43,549,177 (GRCm39) Q635L probably damaging Het
Tshz2 A G 2: 169,804,245 (GRCm39) probably benign Het
Uap1 T C 1: 169,986,415 (GRCm39) E189G possibly damaging Het
Usp21 G A 1: 171,112,974 (GRCm39) probably benign Het
Vmn1r118 G T 7: 20,645,933 (GRCm39) Q114K probably damaging Het
Vmn1r38 A T 6: 66,753,832 (GRCm39) C95S possibly damaging Het
Vmn2r12 A T 5: 109,240,058 (GRCm39) N168K possibly damaging Het
Vmn2r84 T A 10: 130,221,898 (GRCm39) E774V probably damaging Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99,197,278 (GRCm39) missense probably benign 0.07
IGL02596:Esyt3 APN 9 99,210,068 (GRCm39) missense probably benign 0.02
IGL02716:Esyt3 APN 9 99,199,277 (GRCm39) missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99,202,960 (GRCm39) splice site probably benign
IGL03372:Esyt3 APN 9 99,218,109 (GRCm39) splice site probably benign
R0008:Esyt3 UTSW 9 99,220,860 (GRCm39) missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99,200,097 (GRCm39) missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99,198,835 (GRCm39) unclassified probably benign
R1478:Esyt3 UTSW 9 99,200,119 (GRCm39) missense probably benign 0.03
R1710:Esyt3 UTSW 9 99,218,244 (GRCm39) missense probably benign
R1792:Esyt3 UTSW 9 99,240,169 (GRCm39) nonsense probably null
R1913:Esyt3 UTSW 9 99,202,364 (GRCm39) missense probably benign 0.00
R3792:Esyt3 UTSW 9 99,197,334 (GRCm39) missense possibly damaging 0.93
R3793:Esyt3 UTSW 9 99,197,334 (GRCm39) missense possibly damaging 0.93
R3937:Esyt3 UTSW 9 99,218,245 (GRCm39) missense probably benign
R3964:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99,206,290 (GRCm39) missense probably benign
R4436:Esyt3 UTSW 9 99,240,078 (GRCm39) intron probably benign
R5274:Esyt3 UTSW 9 99,200,350 (GRCm39) missense probably benign
R5590:Esyt3 UTSW 9 99,240,466 (GRCm39) utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99,200,260 (GRCm39) missense probably benign 0.00
R6543:Esyt3 UTSW 9 99,220,825 (GRCm39) missense possibly damaging 0.77
R6738:Esyt3 UTSW 9 99,202,346 (GRCm39) missense probably damaging 0.98
R7000:Esyt3 UTSW 9 99,204,206 (GRCm39) missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99,197,338 (GRCm39) missense probably benign 0.11
R7104:Esyt3 UTSW 9 99,220,840 (GRCm39) missense probably damaging 1.00
R7130:Esyt3 UTSW 9 99,200,223 (GRCm39) missense probably benign
R7141:Esyt3 UTSW 9 99,203,493 (GRCm39) missense probably benign 0.12
R7145:Esyt3 UTSW 9 99,201,627 (GRCm39) missense probably damaging 1.00
R7447:Esyt3 UTSW 9 99,203,615 (GRCm39) missense probably damaging 1.00
R7459:Esyt3 UTSW 9 99,240,117 (GRCm39) missense probably benign 0.00
R7767:Esyt3 UTSW 9 99,207,024 (GRCm39) missense probably benign 0.00
R8397:Esyt3 UTSW 9 99,209,966 (GRCm39) missense probably benign 0.01
R8560:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R8882:Esyt3 UTSW 9 99,202,909 (GRCm39) missense probably damaging 0.99
R9320:Esyt3 UTSW 9 99,194,044 (GRCm39) missense probably damaging 1.00
R9537:Esyt3 UTSW 9 99,199,292 (GRCm39) missense probably damaging 0.98
R9786:Esyt3 UTSW 9 99,194,038 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGGTAAGCCCTAATTCTGTTGGTG -3'
(R):5'- AACAGGAGACACTGGCTACC -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- CCTACAATCTACTGATATGCCTGGGG -3'
Posted On 2015-05-15