Incidental Mutation 'R4061:Plagl1'
ID 315868
Institutional Source Beutler Lab
Gene Symbol Plagl1
Ensembl Gene ENSMUSG00000019817
Gene Name pleiomorphic adenoma gene-like 1
Synonyms Zac1
MMRRC Submission 040852-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.408) question?
Stock # R4061 (G1)
Quality Score 123
Status Validated
Chromosome 10
Chromosomal Location 12966576-13007438 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC to TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC at 13004515 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121325] [ENSMUST00000121646] [ENSMUST00000121766] [ENSMUST00000130313] [ENSMUST00000145103] [ENSMUST00000143582] [ENSMUST00000193426]
AlphaFold Q9JLQ4
Predicted Effect probably benign
Transcript: ENSMUST00000121325
SMART Domains Protein: ENSMUSP00000112889
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121646
SMART Domains Protein: ENSMUSP00000112847
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121766
SMART Domains Protein: ENSMUSP00000113710
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135261
Predicted Effect probably benign
Transcript: ENSMUST00000130313
SMART Domains Protein: ENSMUSP00000117321
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145103
Predicted Effect probably benign
Transcript: ENSMUST00000143582
Predicted Effect probably benign
Transcript: ENSMUST00000193426
SMART Domains Protein: ENSMUSP00000141514
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 1e-4 SMART
ZnF_C2H2 32 56 3.2e-6 SMART
ZnF_C2H2 62 84 1.3e-5 SMART
ZnF_C2H2 91 113 1.1e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice exhibit significantly reduced birth weights. Heterozygous mice with a paternal copy of the null allele show reduced fetal and birth weights, altered ossification, dyspnea and background-dependent neonatal lethality, as well as wrinkled skin and curly tails with 30% penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,197,928 (GRCm39) L140Q probably damaging Het
Adam25 A G 8: 41,206,819 (GRCm39) I28M possibly damaging Het
Anks1b A G 10: 90,143,484 (GRCm39) S464G probably damaging Het
AU040320 T A 4: 126,729,488 (GRCm39) M550K probably damaging Het
Cab39l A G 14: 59,737,056 (GRCm39) K59E possibly damaging Het
Cdc5l C T 17: 45,721,816 (GRCm39) A485T probably benign Het
Csmd1 A G 8: 15,995,158 (GRCm39) S2626P probably benign Het
Ctss C T 3: 95,450,345 (GRCm39) R99W probably benign Het
Deptor A T 15: 55,072,177 (GRCm39) M219L probably benign Het
Disp1 A G 1: 182,869,264 (GRCm39) V1052A probably damaging Het
Esyt3 C T 9: 99,202,891 (GRCm39) S504N probably damaging Het
Fat1 A T 8: 45,478,518 (GRCm39) E2521D probably benign Het
Folh1 T A 7: 86,406,170 (GRCm39) Y301F possibly damaging Het
Gm14443 G A 2: 175,011,402 (GRCm39) T348I probably benign Het
Gtpbp2 G A 17: 46,478,253 (GRCm39) R467H probably damaging Het
Hnrnpll T C 17: 80,340,201 (GRCm39) H526R probably benign Het
Iars2 A T 1: 185,035,583 (GRCm39) H552Q possibly damaging Het
Il18r1 G A 1: 40,514,096 (GRCm39) V101I probably benign Het
Impdh2 A G 9: 108,440,003 (GRCm39) R182G possibly damaging Het
Krt12 A T 11: 99,306,841 (GRCm39) M487K unknown Het
Lmln C A 16: 32,886,761 (GRCm39) Y89* probably null Het
Lrrc38 T A 4: 143,077,076 (GRCm39) L113Q probably damaging Het
Mast3 A G 8: 71,233,838 (GRCm39) V969A probably damaging Het
Muc5ac A G 7: 141,364,867 (GRCm39) D1947G possibly damaging Het
Myh13 A T 11: 67,221,715 (GRCm39) I177F possibly damaging Het
Nfasc T C 1: 132,525,583 (GRCm39) Y904C probably damaging Het
Obscn G A 11: 58,899,358 (GRCm39) P1000S probably damaging Het
Or52n4 T A 7: 104,293,680 (GRCm39) K298* probably null Het
Or5t7 T A 2: 86,507,162 (GRCm39) I172F probably damaging Het
Otop2 G A 11: 115,220,201 (GRCm39) G347D probably damaging Het
Pclo A G 5: 14,590,580 (GRCm39) E960G unknown Het
Prl7a1 T C 13: 27,819,832 (GRCm39) I141V possibly damaging Het
Ptpn18 A T 1: 34,512,011 (GRCm39) H45L possibly damaging Het
Sbno1 A T 5: 124,526,635 (GRCm39) M960K probably damaging Het
Slx4ip T A 2: 136,846,937 (GRCm39) S67R probably benign Het
Spata18 A G 5: 73,828,509 (GRCm39) K243E probably damaging Het
Tcp1 A G 17: 13,139,750 (GRCm39) Q265R probably benign Het
Tec C T 5: 72,980,752 (GRCm39) probably benign Het
Thbs4 A G 13: 92,912,605 (GRCm39) probably null Het
Tln1 T A 4: 43,549,177 (GRCm39) Q635L probably damaging Het
Tshz2 A G 2: 169,804,245 (GRCm39) probably benign Het
Uap1 T C 1: 169,986,415 (GRCm39) E189G possibly damaging Het
Usp21 G A 1: 171,112,974 (GRCm39) probably benign Het
Vmn1r118 G T 7: 20,645,933 (GRCm39) Q114K probably damaging Het
Vmn1r38 A T 6: 66,753,832 (GRCm39) C95S possibly damaging Het
Vmn2r12 A T 5: 109,240,058 (GRCm39) N168K possibly damaging Het
Vmn2r84 T A 10: 130,221,898 (GRCm39) E774V probably damaging Het
Other mutations in Plagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Plagl1 APN 10 13,003,616 (GRCm39) unclassified probably benign
R0554:Plagl1 UTSW 10 13,002,926 (GRCm39) missense probably benign 0.07
R0842:Plagl1 UTSW 10 13,004,298 (GRCm39) unclassified probably benign
R0967:Plagl1 UTSW 10 13,003,986 (GRCm39) unclassified probably benign
R1610:Plagl1 UTSW 10 13,004,706 (GRCm39) unclassified probably benign
R2002:Plagl1 UTSW 10 13,004,402 (GRCm39) unclassified probably benign
R2107:Plagl1 UTSW 10 13,004,391 (GRCm39) unclassified probably benign
R2108:Plagl1 UTSW 10 13,004,391 (GRCm39) unclassified probably benign
R2191:Plagl1 UTSW 10 13,004,685 (GRCm39) unclassified probably benign
R4062:Plagl1 UTSW 10 13,004,515 (GRCm39) unclassified probably benign
R4631:Plagl1 UTSW 10 13,003,743 (GRCm39) unclassified probably benign
R4924:Plagl1 UTSW 10 13,003,301 (GRCm39) missense possibly damaging 0.85
R5071:Plagl1 UTSW 10 13,003,005 (GRCm39) missense probably damaging 1.00
R5138:Plagl1 UTSW 10 13,003,919 (GRCm39) unclassified probably benign
R5893:Plagl1 UTSW 10 13,003,938 (GRCm39) unclassified probably benign
R5971:Plagl1 UTSW 10 13,003,490 (GRCm39) missense probably damaging 1.00
R6061:Plagl1 UTSW 10 13,003,639 (GRCm39) unclassified probably benign
R6138:Plagl1 UTSW 10 13,003,490 (GRCm39) missense probably damaging 1.00
R6170:Plagl1 UTSW 10 13,002,975 (GRCm39) missense probably damaging 1.00
R6625:Plagl1 UTSW 10 13,003,806 (GRCm39) unclassified probably benign
R6970:Plagl1 UTSW 10 13,000,860 (GRCm39) missense probably damaging 1.00
R7035:Plagl1 UTSW 10 13,003,977 (GRCm39) unclassified probably benign
R8265:Plagl1 UTSW 10 13,004,625 (GRCm39) missense unknown
R9145:Plagl1 UTSW 10 13,003,872 (GRCm39) missense unknown
R9668:Plagl1 UTSW 10 13,004,466 (GRCm39) missense unknown
R9676:Plagl1 UTSW 10 13,003,955 (GRCm39) missense unknown
U15987:Plagl1 UTSW 10 13,003,490 (GRCm39) missense probably damaging 1.00
Z1176:Plagl1 UTSW 10 13,004,460 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AATAGCACCATCCCTGTGGG -3'
(R):5'- GCACTCACTGCTATTTGGGC -3'

Sequencing Primer
(F):5'- ATAACCTGTCTGGCGCAG -3'
(R):5'- CTGGCTGTGGCTCTTCCG -3'
Posted On 2015-05-15