Mutagenetix > Incidental Mutations

Incidental Mutation 'R4061:Vmn2r84'

315870

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r84

Ensembl Gene

ENSMUSG00000070601

Gene Name

vomeronasal 2, receptor 84

Synonyms

EG625068

MMRRC Submission

040852-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R4061 (G1)

Quality Score

194

Status

Not validated

Chromosome

Chromosomal Location

130385316-130394241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 130386029 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 774 (E774V)

Ref Sequence

ENSEMBL: ENSMUSP00000092079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094502]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094502
AA Change: E774V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: E774V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	77	448	1.3e-27	PFAM
Pfam:NCD3G	508	561	6.9e-21	PFAM
Pfam:7tm_3	594	830	4.6e-55	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (51/54)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Adam25	A	G	8: 40,753,782	I28M	possibly damaging	Het
Anks1b	A	G	10: 90,307,622	S464G	probably damaging	Het
AU040320	T	A	4: 126,835,695	M550K	probably damaging	Het
Cab39l	A	G	14: 59,499,607	K59E	possibly damaging	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Csmd1	A	G	8: 15,945,158	S2626P	probably benign	Het
Ctss	C	T	3: 95,543,034	R99W	probably benign	Het
Deptor	A	T	15: 55,208,781	M219L	probably benign	Het
Disp1	A	G	1: 183,087,700	V1052A	probably damaging	Het
Esyt3	C	T	9: 99,320,838	S504N	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Folh1	T	A	7: 86,756,962	Y301F	possibly damaging	Het
Gm14443	G	A	2: 175,169,609	T348I	probably benign	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Iars2	A	T	1: 185,303,386	H552Q	possibly damaging	Het
Il18r1	G	A	1: 40,474,936	V101I	probably benign	Het
Impdh2	A	G	9: 108,562,804	R182G	possibly damaging	Het
Krt12	A	T	11: 99,416,015	M487K	unknown	Het
Lmln	C	A	16: 33,066,391	Y89*	probably null	Het
Lrrc38	T	A	4: 143,350,506	L113Q	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Muc5ac	A	G	7: 141,811,130	D1947G	possibly damaging	Het
Myh13	A	T	11: 67,330,889	I177F	possibly damaging	Het
Nfasc	T	C	1: 132,597,845	Y904C	probably damaging	Het
Obscn	G	A	11: 59,008,532	P1000S	probably damaging	Het
Olfr1086	T	A	2: 86,676,818	I172F	probably damaging	Het
Olfr658	T	A	7: 104,644,473	K298*	probably null	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pclo	A	G	5: 14,540,566	E960G	unknown	Het
Plagl1	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	10: 13,128,771		probably benign	Het
Prl7a1	T	C	13: 27,635,849	I141V	possibly damaging	Het
Ptpn18	A	T	1: 34,472,930	H45L	possibly damaging	Het
Sbno1	A	T	5: 124,388,572	M960K	probably damaging	Het
Slx4ip	T	A	2: 137,005,017	S67R	probably benign	Het
Spata18	A	G	5: 73,671,166	K243E	probably damaging	Het
Tcp1	A	G	17: 12,920,863	Q265R	probably benign	Het
Tec	C	T	5: 72,823,409		probably benign	Het
Thbs4	A	G	13: 92,776,097		probably null	Het
Tln1	T	A	4: 43,549,177	Q635L	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Uap1	T	C	1: 170,158,846	E189G	possibly damaging	Het
Usp21	G	A	1: 171,285,401		probably benign	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vmn1r38	A	T	6: 66,776,848	C95S	possibly damaging	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het

Other mutations in Vmn2r84

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01461:Vmn2r84	APN	10	130391225	missense	possibly damaging	0.65
IGL01590:Vmn2r84	APN	10	130386095	missense	probably damaging	1.00
IGL01639:Vmn2r84	APN	10	130389272	nonsense	probably null
IGL01843:Vmn2r84	APN	10	130386279	missense	probably benign
IGL01911:Vmn2r84	APN	10	130386408	missense	probably damaging	0.99
IGL01937:Vmn2r84	APN	10	130385886	missense	probably damaging	1.00
IGL01977:Vmn2r84	APN	10	130394066	missense	probably benign	0.11
IGL02177:Vmn2r84	APN	10	130392012	missense	probably benign	0.00
IGL02291:Vmn2r84	APN	10	130390748	missense	probably damaging	1.00
IGL02590:Vmn2r84	APN	10	130391487	splice site	probably benign
IGL02727:Vmn2r84	APN	10	130394126	missense	possibly damaging	0.95
IGL02900:Vmn2r84	APN	10	130387992	splice site	probably benign
IGL03383:Vmn2r84	APN	10	130386687	missense	probably damaging	1.00
PIT4378001:Vmn2r84	UTSW	10	130385915	missense	probably damaging	1.00
R0076:Vmn2r84	UTSW	10	130394193	missense	probably damaging	1.00
R0089:Vmn2r84	UTSW	10	130386719	splice site	probably benign
R0153:Vmn2r84	UTSW	10	130392008	missense	probably benign	0.06
R0611:Vmn2r84	UTSW	10	130386122	missense	probably damaging	1.00
R0883:Vmn2r84	UTSW	10	130391115	missense	probably damaging	0.99
R1237:Vmn2r84	UTSW	10	130387856	splice site	probably null
R1295:Vmn2r84	UTSW	10	130389139	missense	probably benign	0.12
R1401:Vmn2r84	UTSW	10	130391990	missense	possibly damaging	0.89
R1521:Vmn2r84	UTSW	10	130389268	missense	probably benign	0.10
R1590:Vmn2r84	UTSW	10	130391480	critical splice acceptor site	probably null
R1710:Vmn2r84	UTSW	10	130391099	missense	probably benign	0.02
R1891:Vmn2r84	UTSW	10	130386069	missense	possibly damaging	0.78
R1956:Vmn2r84	UTSW	10	130390808	missense	probably benign	0.01
R1957:Vmn2r84	UTSW	10	130390808	missense	probably benign	0.01
R1962:Vmn2r84	UTSW	10	130390722	missense	probably damaging	0.99
R1994:Vmn2r84	UTSW	10	130386009	missense	probably damaging	1.00
R2124:Vmn2r84	UTSW	10	130391231	missense	probably damaging	0.99
R2409:Vmn2r84	UTSW	10	130392071	missense	probably damaging	0.99
R2474:Vmn2r84	UTSW	10	130386523	missense	possibly damaging	0.50
R2851:Vmn2r84	UTSW	10	130394167	missense	probably benign	0.05
R3508:Vmn2r84	UTSW	10	130390908	missense	probably damaging	1.00
R3792:Vmn2r84	UTSW	10	130385800	makesense	probably null
R4051:Vmn2r84	UTSW	10	130390898	missense	probably damaging	1.00
R4091:Vmn2r84	UTSW	10	130391369	missense	probably damaging	1.00
R4190:Vmn2r84	UTSW	10	130391294	nonsense	probably null
R4520:Vmn2r84	UTSW	10	130386522	missense	probably damaging	1.00
R4584:Vmn2r84	UTSW	10	130390713	missense	probably benign	0.00
R4588:Vmn2r84	UTSW	10	130385940	missense	probably damaging	0.98
R4655:Vmn2r84	UTSW	10	130394104	nonsense	probably null
R4860:Vmn2r84	UTSW	10	130385843	missense	probably damaging	0.99
R4860:Vmn2r84	UTSW	10	130385843	missense	probably damaging	0.99
R5022:Vmn2r84	UTSW	10	130386548	missense	probably damaging	1.00
R5146:Vmn2r84	UTSW	10	130386102	missense	probably damaging	1.00
R5237:Vmn2r84	UTSW	10	130385994	missense	probably damaging	0.99
R5695:Vmn2r84	UTSW	10	130389195	missense	probably benign	0.12
R5793:Vmn2r84	UTSW	10	130385885	missense	probably damaging	0.99
R6210:Vmn2r84	UTSW	10	130386245	missense	probably damaging	1.00
R6286:Vmn2r84	UTSW	10	130390868	missense	possibly damaging	0.65
R6580:Vmn2r84	UTSW	10	130389241	missense	possibly damaging	0.93
R6607:Vmn2r84	UTSW	10	130390862	missense	possibly damaging	0.87
R6818:Vmn2r84	UTSW	10	130386278	missense	probably benign	0.09
R6956:Vmn2r84	UTSW	10	130389267	missense	probably damaging	0.98
R6994:Vmn2r84	UTSW	10	130391007	missense	possibly damaging	0.90
R7075:Vmn2r84	UTSW	10	130391072	missense	probably damaging	0.99
R7225:Vmn2r84	UTSW	10	130386683	missense	probably damaging	0.99
R7252:Vmn2r84	UTSW	10	130386410	missense	probably damaging	1.00
R7263:Vmn2r84	UTSW	10	130389208	missense	probably damaging	1.00
R7297:Vmn2r84	UTSW	10	130391250	missense	probably benign	0.19
R7439:Vmn2r84	UTSW	10	130392113	missense	possibly damaging	0.90
R7441:Vmn2r84	UTSW	10	130392113	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ATGGACAGTGCTATCCTGTTTG -3'
(R):5'- AACATCTCCTCCCTTTATTGACAGAG -3'

Sequencing Primer
(F):5'- GACAGTGCTATCCTGTTTGTAAGTCC -3'
(R):5'- TCCTCCCTTTATTGACAGAGATATAC -3'

Posted On

2015-05-15