Incidental Mutation 'R4061:Myh13'
ID315872
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission 040852-MU
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67330889 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 177 (I177F)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081911
AA Change: I177F

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: I177F

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108684
AA Change: I177F

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: I177F

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180845
AA Change: I177F

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: I177F

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.2985 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGCTTTGACATGCCTATGCC -3'
(R):5'- GCCTTTGGTACCATAGTACTCC -3'

Sequencing Primer
(F):5'- TATGCCTCACCCCTAGCAG -3'
(R):5'- GGTACCATAGTACTCCTTACCTGC -3'
Posted On2015-05-15