Incidental Mutation 'R4061:Thbs4'
ID315876
Institutional Source Beutler Lab
Gene Symbol Thbs4
Ensembl Gene ENSMUSG00000021702
Gene Namethrombospondin 4
SynonymsTSP-4, TSP4
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92751590-92794818 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 92776097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022213]
Predicted Effect probably null
Transcript: ENSMUST00000022213
SMART Domains Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
TSPN 26 194 1.66e-51 SMART
Pfam:COMP 220 264 1.2e-24 PFAM
low complexity region 280 290 N/A INTRINSIC
EGF 291 327 1.04e-3 SMART
EGF_CA 328 380 7.29e-8 SMART
EGF_CA 381 421 1.42e-10 SMART
EGF 425 464 4.32e-1 SMART
Pfam:TSP_3 498 533 7.1e-15 PFAM
Pfam:TSP_3 557 592 7.8e-17 PFAM
Pfam:TSP_3 616 653 1.4e-11 PFAM
Pfam:TSP_3 654 693 1.3e-10 PFAM
Pfam:TSP_3 694 729 1e-14 PFAM
Pfam:TSP_C 747 944 3.8e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168299
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Thbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Thbs4 APN 13 92776980 missense probably benign 0.04
IGL02318:Thbs4 APN 13 92763584 missense probably damaging 1.00
IGL02887:Thbs4 APN 13 92790798 missense probably benign 0.00
IGL03205:Thbs4 APN 13 92762774 missense probably damaging 1.00
IGL03382:Thbs4 APN 13 92769548 missense probably benign 0.37
R0087:Thbs4 UTSW 13 92755235 missense probably damaging 0.99
R0128:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0130:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0276:Thbs4 UTSW 13 92775532 missense probably benign 0.00
R0423:Thbs4 UTSW 13 92756571 missense probably damaging 0.99
R0504:Thbs4 UTSW 13 92767184 missense probably benign 0.04
R0708:Thbs4 UTSW 13 92773186 missense probably damaging 1.00
R0836:Thbs4 UTSW 13 92758038 missense probably damaging 1.00
R1078:Thbs4 UTSW 13 92762926 splice site probably benign
R1139:Thbs4 UTSW 13 92774718 missense probably damaging 1.00
R1253:Thbs4 UTSW 13 92776905 missense probably benign 0.17
R1342:Thbs4 UTSW 13 92752417 missense probably damaging 1.00
R1416:Thbs4 UTSW 13 92761533 missense probably benign
R1834:Thbs4 UTSW 13 92761481 missense probably benign 0.00
R1950:Thbs4 UTSW 13 92769571 missense probably damaging 0.99
R2056:Thbs4 UTSW 13 92790879 missense probably benign 0.00
R2184:Thbs4 UTSW 13 92774794 missense probably benign
R2198:Thbs4 UTSW 13 92763271 missense possibly damaging 0.78
R2859:Thbs4 UTSW 13 92790708 missense probably benign 0.02
R3605:Thbs4 UTSW 13 92757959 nonsense probably null
R3783:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3784:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3786:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3787:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R4790:Thbs4 UTSW 13 92762806 missense probably damaging 1.00
R4968:Thbs4 UTSW 13 92758068 missense possibly damaging 0.55
R4983:Thbs4 UTSW 13 92790699 missense probably benign 0.29
R5185:Thbs4 UTSW 13 92775167 missense probably damaging 0.97
R5352:Thbs4 UTSW 13 92763590 missense probably damaging 1.00
R5361:Thbs4 UTSW 13 92776993 missense probably benign
R5589:Thbs4 UTSW 13 92776074 intron probably null
R5700:Thbs4 UTSW 13 92776953 missense probably benign 0.00
R6061:Thbs4 UTSW 13 92751795 missense probably benign 0.00
R6101:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6105:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6227:Thbs4 UTSW 13 92774682 missense probably null 1.00
R6249:Thbs4 UTSW 13 92774707 missense probably damaging 1.00
R6651:Thbs4 UTSW 13 92756536 missense probably benign 0.06
R6735:Thbs4 UTSW 13 92755166 missense possibly damaging 0.71
R6885:Thbs4 UTSW 13 92762869 missense probably damaging 0.96
R6913:Thbs4 UTSW 13 92757936 missense possibly damaging 0.94
R7409:Thbs4 UTSW 13 92773259 nonsense probably null
R7480:Thbs4 UTSW 13 92767221 missense probably benign 0.00
R7682:Thbs4 UTSW 13 92775562 missense probably benign 0.21
R8022:Thbs4 UTSW 13 92752447
Z1177:Thbs4 UTSW 13 92754376
Predicted Primers PCR Primer
(F):5'- GCTGACTCCTCAAATAATTGCTATG -3'
(R):5'- TGCAGCCTCAATAAAAGGGG -3'

Sequencing Primer
(F):5'- TGAAATCTAGGGTTTCTGAATTCG -3'
(R):5'- CCATCAAAAATCCCATTGTCTTCTG -3'
Posted On2015-05-15