Incidental Mutation 'R4061:Lmln'
ID315879
Institutional Source Beutler Lab
Gene Symbol Lmln
Ensembl Gene ENSMUSG00000022802
Gene Nameleishmanolysin-like (metallopeptidase M8 family)
Synonyms5330415H22Rik
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33062521-33127695 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 33066391 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 89 (Y89*)
Ref Sequence ENSEMBL: ENSMUSP00000023497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023497]
Predicted Effect probably null
Transcript: ENSMUST00000023497
AA Change: Y89*
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802
AA Change: Y89*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-metallopeptidase. The encoded protein may play a role in cell migration and invasion. Studies of a similar protein in Drosophila indicate a potential role in mitotic progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Lmln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Lmln APN 16 33083065 missense probably benign 0.08
IGL01346:Lmln APN 16 33117120 missense probably benign 0.00
IGL01664:Lmln APN 16 33080987 missense probably benign 0.03
nemeth UTSW 16 33074097 nonsense probably null
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R0562:Lmln UTSW 16 33117085 nonsense probably null
R1017:Lmln UTSW 16 33088176 missense probably benign
R1557:Lmln UTSW 16 33088211 missense probably benign 0.25
R1617:Lmln UTSW 16 33117130 missense probably damaging 1.00
R2211:Lmln UTSW 16 33109778 missense probably benign 0.00
R4414:Lmln UTSW 16 33109850 missense probably benign 0.00
R4512:Lmln UTSW 16 33088137 missense probably benign 0.01
R4564:Lmln UTSW 16 33109856 missense probably benign 0.09
R4995:Lmln UTSW 16 33074097 nonsense probably null
R5044:Lmln UTSW 16 33074180 missense possibly damaging 0.80
R6109:Lmln UTSW 16 33069111 missense possibly damaging 0.69
R6287:Lmln UTSW 16 33074185 critical splice donor site probably null
R6577:Lmln UTSW 16 33107000 splice site probably null
R6689:Lmln UTSW 16 33104782 missense probably benign 0.19
R7079:Lmln UTSW 16 33067291 missense probably benign 0.02
R7432:Lmln UTSW 16 33089368 missense probably damaging 1.00
R7807:Lmln UTSW 16 33107131 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAATTGGGCAGTTAAATGAACACAC -3'
(R):5'- TTCTGTTCGTTCGATAACCACG -3'

Sequencing Primer
(F):5'- CAGACCATTCACTCTTCTAG -3'
(R):5'- GTCAGGGCAACACAATGA -3'
Posted On2015-05-15