Incidental Mutation 'R4061:Tcp1'
ID315880
Institutional Source Beutler Lab
Gene Symbol Tcp1
Ensembl Gene ENSMUSG00000068039
Gene Namet-complex protein 1
Synonymsp63, CCT, Ccta, Cct1, c-cpn, Tp63, Tcp-1, TRic
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12915701-12925067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12920863 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 265 (Q265R)
Ref Sequence ENSEMBL: ENSMUSP00000116108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043923] [ENSMUST00000079121] [ENSMUST00000089024] [ENSMUST00000143961] [ENSMUST00000151287] [ENSMUST00000160378]
Predicted Effect probably benign
Transcript: ENSMUST00000043923
SMART Domains Protein: ENSMUSP00000045912
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 2.9e-97 PFAM
Pfam:Thiolase_C 274 396 1.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079121
SMART Domains Protein: ENSMUSP00000078123
Gene: ENSMUSG00000057388

DomainStartEndE-ValueType
PDB:4CE4|S 1 180 1e-108 PDB
SCOP:d1jj2m_ 78 141 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083171
Predicted Effect probably benign
Transcript: ENSMUST00000089024
AA Change: Q216R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086418
Gene: ENSMUSG00000068039
AA Change: Q216R

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 486 1.9e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138709
Predicted Effect probably benign
Transcript: ENSMUST00000143961
SMART Domains Protein: ENSMUSP00000116511
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 103 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147724
Predicted Effect probably benign
Transcript: ENSMUST00000151287
AA Change: Q265R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116108
Gene: ENSMUSG00000068039
AA Change: Q265R

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 535 6.3e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151715
Predicted Effect probably benign
Transcript: ENSMUST00000160378
SMART Domains Protein: ENSMUSP00000125454
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 5 248 5.6e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162978
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: There are two electrophoretic alleles known; allele a occurs in all complete t haplotype chromosomes and allele b in wild-type strains. There are multiple changes between the amino acid sequences of the TCP1A and TCP1B proteins encoded by the two alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Tcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Tcp1 APN 17 12919925 missense probably benign 0.00
IGL01859:Tcp1 APN 17 12922684 missense possibly damaging 0.95
IGL02635:Tcp1 APN 17 12923409 missense probably benign 0.35
R0164:Tcp1 UTSW 17 12922747 unclassified probably benign
R0308:Tcp1 UTSW 17 12920419 missense probably benign 0.14
R0452:Tcp1 UTSW 17 12924352 missense probably benign 0.14
R0661:Tcp1 UTSW 17 12923313 missense probably benign 0.02
R0674:Tcp1 UTSW 17 12923244 missense probably damaging 1.00
R1078:Tcp1 UTSW 17 12923204 unclassified probably benign
R1434:Tcp1 UTSW 17 12922606 unclassified probably null
R1678:Tcp1 UTSW 17 12920423 missense probably benign
R1801:Tcp1 UTSW 17 12922202 nonsense probably null
R2063:Tcp1 UTSW 17 12920812 missense probably damaging 0.99
R4078:Tcp1 UTSW 17 12918083 missense probably benign 0.05
R5516:Tcp1 UTSW 17 12924334 missense probably damaging 0.98
R5620:Tcp1 UTSW 17 12919337 splice site probably null
R5764:Tcp1 UTSW 17 12916602 missense probably benign 0.10
R6729:Tcp1 UTSW 17 12923253 missense probably damaging 1.00
R7112:Tcp1 UTSW 17 12917873 missense probably damaging 0.99
R7614:Tcp1 UTSW 17 12922653 missense possibly damaging 0.83
R7718:Tcp1 UTSW 17 12922162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACCAAAACTTTAAGGTTTAGTG -3'
(R):5'- ACAAGAGGCTATACCATGATGC -3'

Sequencing Primer
(F):5'- GACTTCAGCCTGCAGAAA -3'
(R):5'- ATGAGTACACTGCAGCTGTC -3'
Posted On2015-05-15