Mutagenetix > Incidental Mutations

Incidental Mutation 'R4061:Hnrnpll'

315883

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpll

Ensembl Gene

ENSMUSG00000024095

Gene Name

heterogeneous nuclear ribonucleoprotein L-like

Synonyms

2510028H02Rik, Hnrpll, 2810036L13Rik

MMRRC Submission

040852-MU

Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene?

Probably essential (E-score: 0.844) question?

Stock #

R4061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80029487-80062334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80032772 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 526 (H526R)

Ref Sequence

ENSEMBL: ENSMUSP00000139372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]

Predicted Effect

probably benign
Transcript: ENSMUST00000061331
AA Change: H526R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: H526R

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183516

Predicted Effect

probably benign
Transcript: ENSMUST00000184297

SMART Domains

Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184578

Predicted Effect

probably benign
Transcript: ENSMUST00000184635
AA Change: H526R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: H526R

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Meta Mutation Damage Score

0.0584

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4⁺ T cell counts are lower, with a reduction of naï¿½ve CD44^lo T cells occurring as mice age. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Adam25	A	G	8: 40,753,782	I28M	possibly damaging	Het
Anks1b	A	G	10: 90,307,622	S464G	probably damaging	Het
AU040320	T	A	4: 126,835,695	M550K	probably damaging	Het
Cab39l	A	G	14: 59,499,607	K59E	possibly damaging	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Csmd1	A	G	8: 15,945,158	S2626P	probably benign	Het
Ctss	C	T	3: 95,543,034	R99W	probably benign	Het
Deptor	A	T	15: 55,208,781	M219L	probably benign	Het
Disp1	A	G	1: 183,087,700	V1052A	probably damaging	Het
Esyt3	C	T	9: 99,320,838	S504N	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Folh1	T	A	7: 86,756,962	Y301F	possibly damaging	Het
Gm14443	G	A	2: 175,169,609	T348I	probably benign	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Iars2	A	T	1: 185,303,386	H552Q	possibly damaging	Het
Il18r1	G	A	1: 40,474,936	V101I	probably benign	Het
Impdh2	A	G	9: 108,562,804	R182G	possibly damaging	Het
Krt12	A	T	11: 99,416,015	M487K	unknown	Het
Lmln	C	A	16: 33,066,391	Y89*	probably null	Het
Lrrc38	T	A	4: 143,350,506	L113Q	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Muc5ac	A	G	7: 141,811,130	D1947G	possibly damaging	Het
Myh13	A	T	11: 67,330,889	I177F	possibly damaging	Het
Nfasc	T	C	1: 132,597,845	Y904C	probably damaging	Het
Obscn	G	A	11: 59,008,532	P1000S	probably damaging	Het
Olfr1086	T	A	2: 86,676,818	I172F	probably damaging	Het
Olfr658	T	A	7: 104,644,473	K298*	probably null	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pclo	A	G	5: 14,540,566	E960G	unknown	Het
Plagl1	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	10: 13,128,771		probably benign	Het
Prl7a1	T	C	13: 27,635,849	I141V	possibly damaging	Het
Ptpn18	A	T	1: 34,472,930	H45L	possibly damaging	Het
Sbno1	A	T	5: 124,388,572	M960K	probably damaging	Het
Slx4ip	T	A	2: 137,005,017	S67R	probably benign	Het
Spata18	A	G	5: 73,671,166	K243E	probably damaging	Het
Tcp1	A	G	17: 12,920,863	Q265R	probably benign	Het
Tec	C	T	5: 72,823,409		probably benign	Het
Thbs4	A	G	13: 92,776,097		probably null	Het
Tln1	T	A	4: 43,549,177	Q635L	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Uap1	T	C	1: 170,158,846	E189G	possibly damaging	Het
Usp21	G	A	1: 171,285,401		probably benign	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vmn1r38	A	T	6: 66,776,848	C95S	possibly damaging	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het
Vmn2r84	T	A	10: 130,386,029	E774V	probably damaging	Het

Other mutations in Hnrnpll

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
thunder	APN	17	80053571	missense	probably damaging	1.00
IGL01989:Hnrnpll	APN	17	80038740	missense	probably benign	0.15
IGL02093:Hnrnpll	APN	17	80044504	missense	probably benign	0.00
IGL02141:Hnrnpll	APN	17	80050713	missense	probably benign	0.02
IGL02749:Hnrnpll	APN	17	80061991	start codon destroyed	probably null
IGL03213:Hnrnpll	APN	17	80034098	missense	probably damaging	1.00
Grell	UTSW	17	80034105	missense	probably damaging	1.00
Lindsley	UTSW	17	80049847	missense	probably damaging	1.00
R0477:Hnrnpll	UTSW	17	80061832	missense	unknown
R1599:Hnrnpll	UTSW	17	80053625	missense	unknown
R1700:Hnrnpll	UTSW	17	80034105	missense	probably benign	0.18
R1838:Hnrnpll	UTSW	17	80038623	missense	probably damaging	1.00
R1907:Hnrnpll	UTSW	17	80035329	critical splice donor site	probably null
R1978:Hnrnpll	UTSW	17	80044518	missense	probably benign	0.01
R2079:Hnrnpll	UTSW	17	80035377	missense	probably benign	0.01
R4062:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4064:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4226:Hnrnpll	UTSW	17	80049805	critical splice donor site	probably null
R4625:Hnrnpll	UTSW	17	80050862	nonsense	probably null
R5175:Hnrnpll	UTSW	17	80034070	missense	possibly damaging	0.83
R5232:Hnrnpll	UTSW	17	80038678	missense	probably damaging	1.00
R5620:Hnrnpll	UTSW	17	80038622	missense	probably damaging	1.00
R5978:Hnrnpll	UTSW	17	80034191	missense	probably damaging	1.00
R6183:Hnrnpll	UTSW	17	80049876	missense	possibly damaging	0.46
R6374:Hnrnpll	UTSW	17	80049874	missense	possibly damaging	0.51
R7120:Hnrnpll	UTSW	17	80034057	missense	probably benign	0.01
R7429:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7430:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7576:Hnrnpll	UTSW	17	80044514	missense	possibly damaging	0.91
R8001:Hnrnpll	UTSW	17	80038723	nonsense	probably null
R8010:Hnrnpll	UTSW	17	80061956	missense	unknown
R8060:Hnrnpll	UTSW	17	80034105	missense	probably damaging	1.00
R8068:Hnrnpll	UTSW	17	80050852	missense	possibly damaging	0.80
R8381:Hnrnpll	UTSW	17	80030491	missense	probably damaging	1.00
Z1177:Hnrnpll	UTSW	17	80048610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTGGTAGTGATTGAGCGC -3'
(R):5'- CATAGCTTCAAACCAATTTCAGGG -3'

Sequencing Primer
(F):5'- GAGCTTCCACGGCATCAGTTTTG -3'
(R):5'- TCCTCAGAACTTGATGTTAAC -3'

Posted On

2015-05-15