Incidental Mutation 'R4061:Hnrnpll'
ID315883
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Nameheterogeneous nuclear ribonucleoprotein L-like
Synonyms2510028H02Rik, Hnrpll, 2810036L13Rik
MMRRC Submission 040852-MU
Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80029487-80062334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80032772 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 526 (H526R)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
Predicted Effect probably benign
Transcript: ENSMUST00000061331
AA Change: H526R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: H526R

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183516
Predicted Effect probably benign
Transcript: ENSMUST00000184297
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184578
Predicted Effect probably benign
Transcript: ENSMUST00000184635
AA Change: H526R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: H526R

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80053571 missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80038740 missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80044504 missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80050713 missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80061991 start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80034098 missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80061832 missense unknown
R1599:Hnrnpll UTSW 17 80053625 missense unknown
R1700:Hnrnpll UTSW 17 80034105 missense probably benign 0.18
R1838:Hnrnpll UTSW 17 80038623 missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80035329 critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80044518 missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80035377 missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80049805 critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80050862 nonsense probably null
R5175:Hnrnpll UTSW 17 80034070 missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80038678 missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80038622 missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80034191 missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80049876 missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80049874 missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80034057 missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7576:Hnrnpll UTSW 17 80044514 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATCTGGTAGTGATTGAGCGC -3'
(R):5'- CATAGCTTCAAACCAATTTCAGGG -3'

Sequencing Primer
(F):5'- GAGCTTCCACGGCATCAGTTTTG -3'
(R):5'- TCCTCAGAACTTGATGTTAAC -3'
Posted On2015-05-15