Incidental Mutation 'R4062:Mbnl1'
ID315896
Institutional Source Beutler Lab
Gene Symbol Mbnl1
Ensembl Gene ENSMUSG00000027763
Gene Namemuscleblind like splicing factor 1
Synonyms
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location60472830-60629750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60603755 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 136 (L136P)
Ref Sequence ENSEMBL: ENSMUSP00000141474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099087] [ENSMUST00000191747] [ENSMUST00000192607] [ENSMUST00000192807] [ENSMUST00000193517] [ENSMUST00000193518] [ENSMUST00000193647] [ENSMUST00000194069] [ENSMUST00000194201] [ENSMUST00000195077] [ENSMUST00000195817]
Predicted Effect probably damaging
Transcript: ENSMUST00000099087
AA Change: L136P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096686
Gene: ENSMUSG00000027763
AA Change: L136P

DomainStartEndE-ValueType
ZnF_C3H1 14 40 2.57e-3 SMART
ZnF_C3H1 47 72 1.43e-1 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 1.77e-6 SMART
ZnF_C3H1 215 239 2.91e-2 SMART
low complexity region 248 273 N/A INTRINSIC
low complexity region 338 361 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191638
Predicted Effect probably damaging
Transcript: ENSMUST00000191747
AA Change: L44P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142057
Gene: ENSMUSG00000027763
AA Change: L44P

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 86 113 1.77e-6 SMART
ZnF_C3H1 123 147 2.91e-2 SMART
low complexity region 156 185 N/A INTRINSIC
low complexity region 211 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192520
Predicted Effect probably benign
Transcript: ENSMUST00000192607
AA Change: L136P

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142095
Gene: ENSMUSG00000027763
AA Change: L136P

DomainStartEndE-ValueType
ZnF_C3H1 14 40 2.57e-3 SMART
ZnF_C3H1 47 72 1.43e-1 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 1.77e-6 SMART
ZnF_C3H1 215 239 2.91e-2 SMART
low complexity region 248 273 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192757
AA Change: L99P
Predicted Effect probably damaging
Transcript: ENSMUST00000192807
AA Change: L44P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141915
Gene: ENSMUSG00000027763
AA Change: L44P

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 86 113 7.5e-9 SMART
ZnF_C3H1 123 147 1.3e-4 SMART
low complexity region 156 181 N/A INTRINSIC
low complexity region 246 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193130
Predicted Effect probably damaging
Transcript: ENSMUST00000193517
AA Change: L136P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141287
Gene: ENSMUSG00000027763
AA Change: L136P

DomainStartEndE-ValueType
ZnF_C3H1 14 40 1.1e-5 SMART
ZnF_C3H1 47 72 6.1e-4 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 7.5e-9 SMART
ZnF_C3H1 215 239 1.3e-4 SMART
low complexity region 248 272 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193518
AA Change: L39P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142088
Gene: ENSMUSG00000027763
AA Change: L39P

DomainStartEndE-ValueType
ZnF_C3H1 81 108 7.5e-9 SMART
ZnF_C3H1 118 142 1.3e-4 SMART
low complexity region 151 175 N/A INTRINSIC
low complexity region 259 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193647
AA Change: L44P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141536
Gene: ENSMUSG00000027763
AA Change: L44P

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 86 113 7.5e-9 SMART
ZnF_C3H1 123 147 1.3e-4 SMART
low complexity region 156 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194069
AA Change: L136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141474
Gene: ENSMUSG00000027763
AA Change: L136P

DomainStartEndE-ValueType
ZnF_C3H1 14 40 1.1e-5 SMART
ZnF_C3H1 47 72 6.1e-4 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 7.5e-9 SMART
ZnF_C3H1 215 239 1.3e-4 SMART
low complexity region 248 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194201
SMART Domains Protein: ENSMUSP00000141954
Gene: ENSMUSG00000027763

DomainStartEndE-ValueType
ZnF_C3H1 14 40 2.57e-3 SMART
ZnF_C3H1 47 72 1.43e-1 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 111 138 1.23e-5 SMART
ZnF_C3H1 148 172 2.91e-2 SMART
low complexity region 181 206 N/A INTRINSIC
low complexity region 259 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195077
AA Change: L136P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142074
Gene: ENSMUSG00000027763
AA Change: L136P

DomainStartEndE-ValueType
ZnF_C3H1 14 40 1.1e-5 SMART
ZnF_C3H1 47 72 6.1e-4 SMART
low complexity region 89 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195434
Predicted Effect probably damaging
Transcript: ENSMUST00000195817
AA Change: L39P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141576
Gene: ENSMUSG00000027763
AA Change: L39P

DomainStartEndE-ValueType
ZnF_C3H1 81 108 7.5e-9 SMART
ZnF_C3H1 118 142 1.3e-4 SMART
low complexity region 151 180 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the muscleblind protein family which was initially described in Drosophila melanogaster. The encoded protein is a C3H-type zinc finger protein that modulates alternative splicing of pre-mRNAs. Muscleblind proteins bind specifically to expanded dsCUG RNA but not to normal size CUG repeats and may thereby play a role in the pathophysiology of myotonic dystrophy. Mice lacking this gene exhibited muscle abnormalities and cataracts. Several alternatively spliced transcript variants have been described but the full-length natures of only some have been determined. The different isoforms are thought to have different binding specificities and/or splicing activities. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a targeted mutation that disrupts exon 3 exhibit myotonia, cataracts and RNA splicing defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Mbnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Mbnl1 APN 3 60613519 missense possibly damaging 0.45
IGL02382:Mbnl1 APN 3 60625142 nonsense probably null
IGL02970:Mbnl1 APN 3 60613423 missense probably damaging 1.00
R1662:Mbnl1 UTSW 3 60625172 missense probably damaging 1.00
R4577:Mbnl1 UTSW 3 60529778 missense probably damaging 1.00
R4960:Mbnl1 UTSW 3 60595696 start codon destroyed probably null
R6184:Mbnl1 UTSW 3 60615744 missense probably damaging 0.99
R6229:Mbnl1 UTSW 3 60621328 intron probably null
R7219:Mbnl1 UTSW 3 60603823 missense probably benign 0.32
R7397:Mbnl1 UTSW 3 60615630 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGCCTGCTAGATTTGGAG -3'
(R):5'- CTCTGGCTACAAACACTTGAAGAAC -3'

Sequencing Primer
(F):5'- CTGCCTGCTAGATTTGGAGAAAAAC -3'
(R):5'- ACAAACACTTGAAGAACTGTAATGG -3'
Posted On2015-05-15