Incidental Mutation 'R0390:Vwf'
ID 31590
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms 6820430P06Rik, B130011O06Rik
MMRRC Submission 038596-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941

Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R0390 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 125546774-125686679 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 125626361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 891 (Y891*)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000112254
AA Change: Y891*
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: Y891*

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9068:Vwf UTSW 6 125648829 unclassified probably benign
R9128:Vwf UTSW 6 125642730 missense
R9136:Vwf UTSW 6 125599393 splice site probably benign
R9164:Vwf UTSW 6 125565843 missense
R9177:Vwf UTSW 6 125604291 missense
R9334:Vwf UTSW 6 125677946 missense
R9508:Vwf UTSW 6 125555508 missense
R9553:Vwf UTSW 6 125600699 missense
R9660:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9706:Vwf UTSW 6 125624573 missense
R9708:Vwf UTSW 6 125657090 missense
R9712:Vwf UTSW 6 125624573 missense
R9714:Vwf UTSW 6 125624573 missense
R9728:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9758:Vwf UTSW 6 125626267 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCAGTAACACTTGATTGCTGTCCC -3'
(R):5'- ACCTGTGCCAAAATGGCCTGAG -3'

Sequencing Primer
(F):5'- ACTTGATTGCTGTCCCTAGTG -3'
(R):5'- AAACTTCCTACATCGTTGGGC -3'
Posted On 2013-04-24