Incidental Mutation 'R4062:Alkbh2'
ID315902
Institutional Source Beutler Lab
Gene Symbol Alkbh2
Ensembl Gene ENSMUSG00000044339
Gene NamealkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
SynonymsAbh2, mABH2
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114123926-114128218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114124226 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 148 (E148K)
Ref Sequence ENSEMBL: ENSMUSP00000107898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000149418] [ENSMUST00000200119]
Predicted Effect probably benign
Transcript: ENSMUST00000031588
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053657
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112279
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Predicted Effect probably benign
Transcript: ENSMUST00000200119
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Meta Mutation Damage Score 0.2232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable and overtly normal but show progressive accumulation of 1-methyladenine (1meA) in their genomic DNA due to impaired DNA repair. Mutant MEFs fail to remove methyl methane sulfate (MMS)-induced 1meA from genomic DNA and showincreased cytotoxicity after MMS exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Alkbh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Alkbh2 APN 5 114125572 missense probably benign
R0326:Alkbh2 UTSW 5 114123950 makesense probably null
R0480:Alkbh2 UTSW 5 114125535 missense probably damaging 1.00
R0962:Alkbh2 UTSW 5 114123953 missense possibly damaging 0.94
R1214:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1215:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1280:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1282:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1309:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1340:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1371:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1443:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1445:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1545:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1546:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1629:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1631:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1707:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1769:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1920:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1921:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1922:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1984:Alkbh2 UTSW 5 114124054 missense probably benign 0.12
R2140:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R2142:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R3800:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R3981:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4032:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4064:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4163:Alkbh2 UTSW 5 114127552 missense probably damaging 1.00
R4569:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4570:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4624:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4625:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4626:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4627:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4628:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4630:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4633:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4801:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4802:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4803:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCATCAGCAGGCTTCCGTG -3'
(R):5'- GGCCTGCAGGTATTGTAAGAAG -3'

Sequencing Primer
(F):5'- AGGCTTCCGTGTGCCAG -3'
(R):5'- CCCAAATAGTTCTACTAGCTGGGG -3'
Posted On2015-05-15