Incidental Mutation 'R4062:Gcdh'
ID315911
Institutional Source Beutler Lab
Gene Symbol Gcdh
Ensembl Gene ENSMUSG00000003809
Gene Nameglutaryl-Coenzyme A dehydrogenase
SynonymsD17825
MMRRC Submission 040971-MU
Accession Numbers

NCBI RefSeq: NM_008097.2, NM_001044744.1; MGI: 104541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84886393-84893921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84892453 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 152 (I152V)
Ref Sequence ENSEMBL: ENSMUSP00000105367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003907] [ENSMUST00000003922] [ENSMUST00000109745] [ENSMUST00000136026] [ENSMUST00000142748]
Predicted Effect probably damaging
Transcript: ENSMUST00000003907
AA Change: I161V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003907
Gene: ENSMUSG00000003809
AA Change: I161V

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 61 172 1.5e-29 PFAM
Pfam:Acyl-CoA_dh_M 176 269 3.8e-22 PFAM
Pfam:Acyl-CoA_dh_1 287 429 2.9e-30 PFAM
Pfam:Acyl-CoA_dh_2 295 418 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003922
Predicted Effect probably damaging
Transcript: ENSMUST00000109745
AA Change: I152V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105367
Gene: ENSMUSG00000003809
AA Change: I152V

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 61 172 8.2e-28 PFAM
Pfam:Acyl-CoA_dh_M 176 230 2.2e-21 PFAM
low complexity region 269 280 N/A INTRINSIC
Pfam:Acyl-CoA_dh_1 287 429 2.6e-30 PFAM
Pfam:Acyl-CoA_dh_2 295 418 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128023
Predicted Effect probably benign
Transcript: ENSMUST00000136026
SMART Domains Protein: ENSMUSP00000122159
Gene: ENSMUSG00000003824

DomainStartEndE-ValueType
coiled coil region 52 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139180
Predicted Effect probably benign
Transcript: ENSMUST00000142748
SMART Domains Protein: ENSMUSP00000116584
Gene: ENSMUSG00000003809

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
PDB:2R0M|A 45 66 5e-6 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 2182942
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family. It catalyzes the oxidative decarboxylation of glutaryl-CoA to crotonyl-CoA and CO(2) in the degradative pathway of L-lysine, L-hydroxylysine, and L-tryptophan metabolism. It uses electron transfer flavoprotein as its electron acceptor. The enzyme exists in the mitochondrial matrix as a homotetramer of 45-kD subunits. Mutations in this gene result in the metabolic disorder glutaric aciduria type 1, which is also known as glutaric acidemia type I. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 12. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a mild motor deficit associated with a diffuse spongiform myelinopathy and elevated levels of glutaric acid and 3-hydroxyglutaric acid. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Gcdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Gcdh APN 8 84888517 unclassified probably benign
IGL01533:Gcdh APN 8 84889362 missense probably damaging 1.00
IGL01616:Gcdh APN 8 84893659 missense probably damaging 1.00
IGL01903:Gcdh APN 8 84888604 missense probably damaging 1.00
IGL01987:Gcdh APN 8 84893481 splice site probably benign
IGL02976:Gcdh APN 8 84888578 missense probably damaging 1.00
IGL03333:Gcdh APN 8 84891071 missense probably benign 0.00
P0014:Gcdh UTSW 8 84888525 critical splice donor site probably null
R0898:Gcdh UTSW 8 84893560 missense possibly damaging 0.66
R1184:Gcdh UTSW 8 84893442 splice site probably benign
R1983:Gcdh UTSW 8 84890910 missense possibly damaging 0.90
R3755:Gcdh UTSW 8 84893480 splice site probably benign
R5507:Gcdh UTSW 8 84892857 missense probably damaging 1.00
R7001:Gcdh UTSW 8 84890911 missense probably benign 0.01
R7857:Gcdh UTSW 8 84892464 missense probably damaging 1.00
R7940:Gcdh UTSW 8 84892464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGACATGGACACAGGTG -3'
(R):5'- GGTTTGAGAGGAACAAAGTCCTAAC -3'

Sequencing Primer
(F):5'- CTGACATGGACACAGGTGGTCTG -3'
(R):5'- TTCCAGAAGGGCCATATTACAG -3'
Posted On2015-05-15