Incidental Mutation 'R4062:Cdc40'
ID315916
Institutional Source Beutler Lab
Gene Symbol Cdc40
Ensembl Gene ENSMUSG00000038446
Gene Namecell division cycle 40
SynonymsPRP17, 1200003H23Rik, EHB3
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40831621-40883311 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 40849852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044166]
Predicted Effect probably null
Transcript: ENSMUST00000044166
SMART Domains Protein: ENSMUSP00000044305
Gene: ENSMUSG00000038446

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
WD40 277 317 6.04e-8 SMART
WD40 321 360 8.1e-9 SMART
WD40 363 404 1.58e-2 SMART
WD40 407 446 9.52e-6 SMART
WD40 452 489 2.13e1 SMART
WD40 495 536 1.4e-3 SMART
WD40 539 579 3.37e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216025
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp17 protein, which functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. It suggests that this protein may play a role in cell cycle progression. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Cdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cdc40 APN 10 40843128 missense probably damaging 1.00
IGL02333:Cdc40 APN 10 40867859 missense probably benign 0.00
IGL02490:Cdc40 APN 10 40841771 missense probably benign 0.39
IGL02878:Cdc40 APN 10 40843122 missense probably damaging 0.96
IGL02976:Cdc40 APN 10 40882921 missense probably benign
IGL03058:Cdc40 APN 10 40849828 missense probably benign 0.01
IGL03178:Cdc40 APN 10 40847989 missense probably benign
R0409:Cdc40 UTSW 10 40847168 missense probably damaging 0.99
R0522:Cdc40 UTSW 10 40857612 missense probably benign 0.21
R0608:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R0730:Cdc40 UTSW 10 40844956 splice site probably benign
R1712:Cdc40 UTSW 10 40841376 missense probably damaging 1.00
R1940:Cdc40 UTSW 10 40883071 unclassified probably benign
R5035:Cdc40 UTSW 10 40849813 missense probably benign 0.18
R5628:Cdc40 UTSW 10 40851053 missense probably benign 0.03
R6933:Cdc40 UTSW 10 40844996 missense probably damaging 0.96
R7082:Cdc40 UTSW 10 40867873 missense probably benign
R7419:Cdc40 UTSW 10 40841443 missense probably damaging 1.00
R7625:Cdc40 UTSW 10 40848052 missense probably benign 0.15
RF041:Cdc40 UTSW 10 40843123 missense probably damaging 1.00
X0026:Cdc40 UTSW 10 40841452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAACAGTGCAAGCAATTGG -3'
(R):5'- ACTTCTGTCTAGCCATTGGGG -3'

Sequencing Primer
(F):5'- GCAAGCAATTGGTATTATATGGCG -3'
(R):5'- GGGGGAGGAGACAGACTC -3'
Posted On2015-05-15