Incidental Mutation 'R4062:Otop2'
ID315921
Institutional Source Beutler Lab
Gene Symbol Otop2
Ensembl Gene ENSMUSG00000050201
Gene Nameotopetrin 2
Synonyms
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115307163-115332303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115329375 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 347 (G347D)
Ref Sequence ENSEMBL: ENSMUSP00000102154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055490] [ENSMUST00000106544]
Predicted Effect probably damaging
Transcript: ENSMUST00000055490
AA Change: G347D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062109
Gene: ENSMUSG00000050201
AA Change: G347D

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 225 1e-18 PFAM
Pfam:Otopetrin 214 451 5.5e-20 PFAM
Pfam:Otopetrin 479 550 8.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106544
AA Change: G347D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102154
Gene: ENSMUSG00000050201
AA Change: G347D

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 450 7.9e-54 PFAM
Pfam:Otopetrin 476 550 2e-16 PFAM
Meta Mutation Damage Score 0.8486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Otop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Otop2 APN 11 115331909 missense probably damaging 1.00
IGL01832:Otop2 APN 11 115326943 missense probably benign
IGL02114:Otop2 APN 11 115326980 missense possibly damaging 0.64
IGL02432:Otop2 APN 11 115329162 missense probably damaging 0.99
IGL02453:Otop2 APN 11 115324629 nonsense probably null
IGL02986:Otop2 APN 11 115329567 missense probably benign 0.11
IGL03225:Otop2 APN 11 115329807 missense probably damaging 1.00
R0402:Otop2 UTSW 11 115326408 splice site probably benign
R0553:Otop2 UTSW 11 115329462 missense probably damaging 0.98
R1209:Otop2 UTSW 11 115324643 missense possibly damaging 0.70
R1497:Otop2 UTSW 11 115329849 unclassified probably null
R1765:Otop2 UTSW 11 115324678 missense probably benign 0.04
R1822:Otop2 UTSW 11 115324628 missense probably benign 0.41
R1926:Otop2 UTSW 11 115326955 missense probably benign 0.00
R2151:Otop2 UTSW 11 115329411 missense possibly damaging 0.90
R2192:Otop2 UTSW 11 115326931 missense possibly damaging 0.63
R2350:Otop2 UTSW 11 115326850 missense probably damaging 0.97
R2352:Otop2 UTSW 11 115329101 missense probably damaging 1.00
R2915:Otop2 UTSW 11 115329146 missense probably benign 0.07
R3614:Otop2 UTSW 11 115329146 missense probably benign 0.07
R4060:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4061:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4063:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4064:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4184:Otop2 UTSW 11 115329845 missense probably benign 0.05
R4844:Otop2 UTSW 11 115323375 splice site probably null
R5681:Otop2 UTSW 11 115326859 missense probably damaging 1.00
R5713:Otop2 UTSW 11 115329044 missense probably damaging 0.98
R6738:Otop2 UTSW 11 115329492 missense probably damaging 1.00
R6975:Otop2 UTSW 11 115329326 missense possibly damaging 0.93
RF013:Otop2 UTSW 11 115323666 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAATGTGGGAAGGCTGCTC -3'
(R):5'- CTGAGCGATCATGAGTAGAGC -3'

Sequencing Primer
(F):5'- TCCAGGGTCAGCCTGTTC -3'
(R):5'- CGTGGGACAGGTTGAGC -3'
Posted On2015-05-15