Incidental Mutation 'R4062:Adam17'
ID315923
Institutional Source Beutler Lab
Gene Symbol Adam17
Ensembl Gene ENSMUSG00000052593
Gene Namea disintegrin and metallopeptidase domain 17
SynonymsCD156b, Tace
MMRRC Submission 040971-MU
Accession Numbers

Genbank: NM_009615; MGI: 1096335

Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location21323509-21373632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21325457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 787 (D787G)
Ref Sequence ENSEMBL: ENSMUSP00000099087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000076813] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000145118] [ENSMUST00000221693] [ENSMUST00000223345] [ENSMUST00000232107] [ENSMUST00000232526]
Predicted Effect probably damaging
Transcript: ENSMUST00000064536
AA Change: D768G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: D768G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076813
SMART Domains Protein: ENSMUSP00000076090
Gene: ENSMUSG00000062054

DomainStartEndE-ValueType
Pfam:Lipase_GDSL 18 213 1.3e-34 PFAM
Pfam:Lipase_GDSL_2 19 209 2.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101551
AA Change: D787G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: D787G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127974
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141799
Predicted Effect probably benign
Transcript: ENSMUST00000145118
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155115
Predicted Effect probably benign
Transcript: ENSMUST00000221693
Predicted Effect probably benign
Transcript: ENSMUST00000222344
Predicted Effect probably benign
Transcript: ENSMUST00000223345
Predicted Effect probably benign
Transcript: ENSMUST00000232107
Predicted Effect probably benign
Transcript: ENSMUST00000232526
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Adam17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21328109 missense probably damaging 1.00
IGL01340:Adam17 APN 12 21330057 nonsense probably null
IGL01973:Adam17 APN 12 21349943 missense probably damaging 1.00
IGL02223:Adam17 APN 12 21361705 missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21345697 missense probably damaging 1.00
Steinway UTSW 12 21353948 missense probably damaging 1.00
wavedx UTSW 12 21340750 missense probably damaging 1.00
R0014:Adam17 UTSW 12 21336644 missense probably benign 0.36
R0080:Adam17 UTSW 12 21329048 splice site probably benign
R0082:Adam17 UTSW 12 21329048 splice site probably benign
R0324:Adam17 UTSW 12 21349938 missense probably benign 0.00
R0511:Adam17 UTSW 12 21340458 splice site probably benign
R0745:Adam17 UTSW 12 21332221 splice site probably benign
R1314:Adam17 UTSW 12 21329071 missense probably damaging 1.00
R1547:Adam17 UTSW 12 21353957 missense probably damaging 1.00
R1594:Adam17 UTSW 12 21340470 critical splice donor site probably null
R1607:Adam17 UTSW 12 21334138 splice site probably null
R1812:Adam17 UTSW 12 21361767 missense probably damaging 0.97
R2020:Adam17 UTSW 12 21349875 missense probably damaging 1.00
R3408:Adam17 UTSW 12 21329118 missense probably damaging 1.00
R3735:Adam17 UTSW 12 21325412 missense probably benign 0.05
R3886:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R3888:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R4415:Adam17 UTSW 12 21345701 missense possibly damaging 0.90
R4563:Adam17 UTSW 12 21332088 missense probably damaging 1.00
R4658:Adam17 UTSW 12 21332160 missense probably damaging 1.00
R4763:Adam17 UTSW 12 21334015 missense probably benign
R4793:Adam17 UTSW 12 21347395 missense probably benign
R5101:Adam17 UTSW 12 21373405 missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21343019 intron probably benign
R5514:Adam17 UTSW 12 21340519 missense probably damaging 0.98
R5592:Adam17 UTSW 12 21334137 missense probably damaging 1.00
R5874:Adam17 UTSW 12 21329086 missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6451:Adam17 UTSW 12 21342882 missense probably benign 0.00
R6930:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6970:Adam17 UTSW 12 21345668 missense probably benign 0.06
R7213:Adam17 UTSW 12 21336678 nonsense probably null
R7302:Adam17 UTSW 12 21355693 intron probably benign
R7361:Adam17 UTSW 12 21325601 missense probably damaging 0.98
R7667:Adam17 UTSW 12 21333952 critical splice donor site probably null
R7799:Adam17 UTSW 12 21340492 missense probably damaging 1.00
X0063:Adam17 UTSW 12 21332585 missense probably benign 0.17
Z1176:Adam17 UTSW 12 21361737 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGGTTCCCCACTAGCACTC -3'
(R):5'- AGCCCAGGGTTACTGTACAG -3'

Sequencing Primer
(F):5'- ACTAGCACTCTGTCTCTTTGCTG -3'
(R):5'- CCAGGGTTACTGTACAGTGTAATGAC -3'
Posted On2015-05-15