Incidental Mutation 'R4062:Nkd2'
ID315925
Institutional Source Beutler Lab
Gene Symbol Nkd2
Ensembl Gene ENSMUSG00000021567
Gene Namenaked cuticle 2
Synonyms2210403L10Rik
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73818534-73847631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73822690 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 258 (G258R)
Ref Sequence ENSEMBL: ENSMUSP00000113794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022051] [ENSMUST00000022051] [ENSMUST00000118096] [ENSMUST00000118096] [ENSMUST00000222004]
Predicted Effect probably null
Transcript: ENSMUST00000022051
AA Change: G270R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022051
Gene: ENSMUSG00000021567
AA Change: G270R

DomainStartEndE-ValueType
SCOP:d1alva_ 133 160 7e-3 SMART
low complexity region 341 358 N/A INTRINSIC
low complexity region 380 390 N/A INTRINSIC
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022051
AA Change: G270R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022051
Gene: ENSMUSG00000021567
AA Change: G270R

DomainStartEndE-ValueType
SCOP:d1alva_ 133 160 7e-3 SMART
low complexity region 341 358 N/A INTRINSIC
low complexity region 380 390 N/A INTRINSIC
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118096
AA Change: G258R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113794
Gene: ENSMUSG00000021567
AA Change: G258R

DomainStartEndE-ValueType
SCOP:d1alva_ 121 148 7e-3 SMART
low complexity region 329 346 N/A INTRINSIC
low complexity region 368 378 N/A INTRINSIC
low complexity region 429 447 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118096
AA Change: G258R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113794
Gene: ENSMUSG00000021567
AA Change: G258R

DomainStartEndE-ValueType
SCOP:d1alva_ 121 148 7e-3 SMART
low complexity region 329 346 N/A INTRINSIC
low complexity region 368 378 N/A INTRINSIC
low complexity region 429 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138899
Predicted Effect probably benign
Transcript: ENSMUST00000222004
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function as negative regulators of Wnt receptor signaling through interaction with Dishevelled family members. The encoded protein participates in the delivery of transforming growth factor alpha-containing vesicles to the cell membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a reporter allele are viable and fertile but show a slight and background-sensitive reduction in average litter size relative to control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Nkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Nkd2 APN 13 73821480 missense probably benign 0.01
IGL03121:Nkd2 APN 13 73821379 missense probably benign 0.11
R0635:Nkd2 UTSW 13 73826894 missense probably benign 0.03
R4546:Nkd2 UTSW 13 73823356 missense probably benign 0.02
R4724:Nkd2 UTSW 13 73847005 missense probably damaging 0.99
R4934:Nkd2 UTSW 13 73822722 missense probably damaging 1.00
R5051:Nkd2 UTSW 13 73825076 missense probably benign 0.06
R5353:Nkd2 UTSW 13 73821438 missense probably damaging 0.99
R6228:Nkd2 UTSW 13 73821460 missense probably benign 0.00
R6242:Nkd2 UTSW 13 73822786 missense probably damaging 0.98
R6530:Nkd2 UTSW 13 73822690 missense probably null 1.00
R7475:Nkd2 UTSW 13 73825742 missense probably damaging 1.00
R7486:Nkd2 UTSW 13 73847442 splice site probably benign
R7530:Nkd2 UTSW 13 73846959 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AACCACCTTGCTTTCCAGGC -3'
(R):5'- CTGCAAGCAGCCCTGTTATATG -3'

Sequencing Primer
(F):5'- GCCCCTTGCCAATGACAG -3'
(R):5'- GACTTAAAGTCTGGCCTTGAGC -3'
Posted On2015-05-15