Incidental Mutation 'R4062:Isl1'
ID315927
Institutional Source Beutler Lab
Gene Symbol Isl1
Ensembl Gene ENSMUSG00000042258
Gene NameISL1 transcription factor, LIM/homeodomain
SynonymsIslet 1
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location116298281-116309689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116303090 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 241 (I241F)
Ref Sequence ENSEMBL: ENSMUSP00000135567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036060] [ENSMUST00000176044]
Predicted Effect probably benign
Transcript: ENSMUST00000036060
AA Change: I241F

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044879
Gene: ENSMUSG00000042258
AA Change: I241F

DomainStartEndE-ValueType
LIM 16 70 1.39e-13 SMART
LIM 78 132 4.99e-15 SMART
HOX 181 243 1.83e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176044
AA Change: I241F

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135567
Gene: ENSMUSG00000042258
AA Change: I241F

DomainStartEndE-ValueType
LIM 16 70 1.39e-13 SMART
LIM 78 132 4.99e-15 SMART
HOX 181 243 1.83e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176812
SMART Domains Protein: ENSMUSP00000135793
Gene: ENSMUSG00000042258

DomainStartEndE-ValueType
LIM 1 40 1.3e-5 SMART
HOX 89 151 9.4e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177469
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to develop motor neurons and die by embryonic day 11.5 with abnormal heart and pancreas development. Mice heterozygous for an ENU mutation exhibit chronic otitis media and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Isl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Isl1 APN 13 116303053 missense probably benign 0.02
IGL03251:Isl1 APN 13 116305449 missense probably benign
R1897:Isl1 UTSW 13 116303330 missense probably benign 0.12
R1928:Isl1 UTSW 13 116308417 missense probably damaging 1.00
R2940:Isl1 UTSW 13 116308299 missense possibly damaging 0.53
R4795:Isl1 UTSW 13 116305430 missense probably benign 0.41
R4796:Isl1 UTSW 13 116305430 missense probably benign 0.41
R4836:Isl1 UTSW 13 116303083 missense probably benign 0.06
R4839:Isl1 UTSW 13 116301684 missense probably damaging 1.00
R4870:Isl1 UTSW 13 116308270 splice site probably benign
R5231:Isl1 UTSW 13 116301657 missense probably benign 0.17
R6220:Isl1 UTSW 13 116303267 missense probably benign 0.24
R7231:Isl1 UTSW 13 116303290 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATCTCGGCCTTCTTGTAGAGAGTAG -3'
(R):5'- GGACTGTGCTCAACGAGAAG -3'

Sequencing Primer
(F):5'- GACACTATACACCTGGGTTTAGG -3'
(R):5'- GAGAAGCAGCTGCACACCTTG -3'
Posted On2015-05-15