Incidental Mutation 'R4062:Lcp1'
ID315930
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Namelymphocyte cytosolic protein 1
SynonymsD14Ertd310e, L-fimbrin, Pls2, L-plastin
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75131101-75230842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75215180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 442 (V442A)
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]
Predicted Effect probably damaging
Transcript: ENSMUST00000124499
AA Change: V442A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: V442A

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131802
AA Change: V442A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: V442A

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145303
AA Change: V442A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: V442A

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75227093 critical splice donor site probably null
IGL01768:Lcp1 APN 14 75224133 missense probably benign 0.40
IGL01801:Lcp1 APN 14 75199375 missense probably benign 0.10
IGL01940:Lcp1 APN 14 75216365 missense probably benign 0.17
IGL02135:Lcp1 APN 14 75200486 missense probably benign 0.00
IGL02185:Lcp1 APN 14 75229300 missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75224096 missense probably benign 0.04
IGL02604:Lcp1 APN 14 75224126 missense probably benign 0.11
R0244:Lcp1 UTSW 14 75227001 missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75199420 missense probably null 0.59
R0313:Lcp1 UTSW 14 75199433 missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R0811:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R0812:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R1200:Lcp1 UTSW 14 75229302 missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75199444 critical splice donor site probably null
R1915:Lcp1 UTSW 14 75199297 missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75200401 missense probably benign 0.01
R2064:Lcp1 UTSW 14 75198075 critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75206129 missense possibly damaging 0.68
R4521:Lcp1 UTSW 14 75215168 missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75200408 missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75200489 missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75208471 nonsense probably null
R5539:Lcp1 UTSW 14 75229298 missense probably benign 0.08
R5561:Lcp1 UTSW 14 75212508 missense probably benign 0.01
R5724:Lcp1 UTSW 14 75226982 missense probably benign 0.18
R5989:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R6731:Lcp1 UTSW 14 75206189 missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75210506 missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75200431 missense probably benign 0.12
R7698:Lcp1 UTSW 14 75206211 nonsense probably null
S24628:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75227086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACCAAGTTTCTAGGGTTCC -3'
(R):5'- CACTGCAATGACAGGTTCAG -3'

Sequencing Primer
(F):5'- TTCCTAGGGACGTTGCAGGAAC -3'
(R):5'- ATGGAAGTCTTCATAAGGTCTCTGTC -3'
Posted On2015-05-15