Incidental Mutation 'R4062:Cd320'
ID315934
Institutional Source Beutler Lab
Gene Symbol Cd320
Ensembl Gene ENSMUSG00000002308
Gene NameCD320 antigen
SynonymsVLDL, NG29, D17Ertd716e, 8D6, 425O18-1
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33843091-33849774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33847517 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 90 (N90K)
Ref Sequence ENSEMBL: ENSMUSP00000002379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002379] [ENSMUST00000087559]
Predicted Effect probably benign
Transcript: ENSMUST00000002379
AA Change: N90K

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002379
Gene: ENSMUSG00000002308
AA Change: N90K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LDLa 46 84 1.16e-14 SMART
LDLa 123 161 4.24e-8 SMART
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087559
AA Change: N76K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084839
Gene: ENSMUSG00000002308
AA Change: N76K

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LDLa 32 70 1.16e-14 SMART
LDLa 109 147 4.24e-8 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173418
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the transcobalamin receptor that is expressed at the cell surface. It mediates the cellular uptake of transcobalamin bound cobalamin (vitamin B12), and is involved in B-cell proliferation and immunoglobulin secretion. Mutations in this gene are associated with methylmalonic aciduria. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: The homozygous mutant and heterozygous mice exhibited an increased mean retinal artery-to-vein ratio when compared with controls. Mice homozygous for a gene trap knock-out allele exhibit vitamin B12 deficiency in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Cd320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Cd320 APN 17 33843240 unclassified probably benign
R0107:Cd320 UTSW 17 33848085 missense probably benign
R0722:Cd320 UTSW 17 33846030 missense possibly damaging 0.65
R1272:Cd320 UTSW 17 33848164 missense possibly damaging 0.53
R1515:Cd320 UTSW 17 33847639 missense probably damaging 1.00
R4663:Cd320 UTSW 17 33848178 missense probably null 1.00
R4981:Cd320 UTSW 17 33847575 missense probably benign 0.00
R5516:Cd320 UTSW 17 33848047 missense possibly damaging 0.95
R6376:Cd320 UTSW 17 33847517 missense probably benign 0.08
R6536:Cd320 UTSW 17 33847503 missense probably benign 0.00
R6600:Cd320 UTSW 17 33847617 missense probably damaging 1.00
R7417:Cd320 UTSW 17 33847556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGATTTAGAGCGGATTGGGTAAC -3'
(R):5'- ACTGGAGTCAAGACAGTCTGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- AAGACAGTCTGGGTGGCCATC -3'
Posted On2015-05-15