Incidental Mutation 'R4062:Greb1l'
ID315936
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 040971-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10522150 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 749 (V749I)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: V749I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: V749I

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: V640I

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: V640I

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7915:Greb1l UTSW 18 10542056 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GTGCCCAGTATTGGTCAACAC -3'
(R):5'- CAGTGCCTTTACACCATGACTAAAG -3'

Sequencing Primer
(F):5'- GGTCAACACTGAGCTCTCTC -3'
(R):5'- CACCATGACTAAAGGGTTCCTTAGG -3'
Posted On2015-05-15