Incidental Mutation 'R4062:Rab3il1'
ID315938
Institutional Source Beutler Lab
Gene Symbol Rab3il1
Ensembl Gene ENSMUSG00000024663
Gene NameRAB3A interacting protein (rabin3)-like 1
Synonyms1200014K04Rik, Rab3ail1
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10001669-10038380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10026624 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 36 (S36P)
Ref Sequence ENSEMBL: ENSMUSP00000121449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113161] [ENSMUST00000117641] [ENSMUST00000121418] [ENSMUST00000131407] [ENSMUST00000137637] [ENSMUST00000144788] [ENSMUST00000149967]
Predicted Effect probably benign
Transcript: ENSMUST00000113161
AA Change: S36P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108786
Gene: ENSMUSG00000024663
AA Change: S36P

DomainStartEndE-ValueType
Pfam:Sec2p 90 173 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117641
AA Change: S36P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113551
Gene: ENSMUSG00000024663
AA Change: S36P

DomainStartEndE-ValueType
Pfam:Sec2p 89 158 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121418
SMART Domains Protein: ENSMUSP00000113828
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 129 4.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131407
SMART Domains Protein: ENSMUSP00000115976
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 86 7.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137637
SMART Domains Protein: ENSMUSP00000120366
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 58 5.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144788
AA Change: S36P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121449
Gene: ENSMUSG00000024663
AA Change: S36P

DomainStartEndE-ValueType
Pfam:Sec2p 89 198 4.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149967
SMART Domains Protein: ENSMUSP00000120401
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 51 3.2e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor for the ras-related protein Rab3A. The encoded protein binds Rab3a and the inositol hexakisphosphate kinase InsP6K1. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Emilin3 T C 2: 160,907,796 T631A probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Rab3il1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Rab3il1 UTSW 19 10033751 missense probably damaging 1.00
R0324:Rab3il1 UTSW 19 10028289 missense probably damaging 1.00
R0613:Rab3il1 UTSW 19 10028364 missense probably damaging 1.00
R0648:Rab3il1 UTSW 19 10027388 small insertion probably benign
R3752:Rab3il1 UTSW 19 10030477 missense probably benign 0.05
R3765:Rab3il1 UTSW 19 10028309 missense probably damaging 1.00
R4245:Rab3il1 UTSW 19 10030154 missense probably damaging 1.00
R4803:Rab3il1 UTSW 19 10027444 missense possibly damaging 0.78
R4820:Rab3il1 UTSW 19 10026670 missense probably benign 0.01
R8047:Rab3il1 UTSW 19 10033802 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTATGTCACCTAGGGTTGGTCC -3'
(R):5'- AGCTTTCTGGGCTCACTCAG -3'

Sequencing Primer
(F):5'- GTCCCTGGGCTCAGTTCTG -3'
(R):5'- TTCTGGGCTCACTCAGTGCAG -3'
Posted On2015-05-15