Incidental Mutation 'R4063:1700034J05Rik'
ID315960
Institutional Source Beutler Lab
Gene Symbol 1700034J05Rik
Ensembl Gene ENSMUSG00000040163
Gene NameRIKEN cDNA 1700034J05 gene
Synonyms
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4063 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146950329-146954422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146953108 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 145 (F145L)
Ref Sequence ENSEMBL: ENSMUSP00000107249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000036592] [ENSMUST00000111622] [ENSMUST00000111623] [ENSMUST00000203730]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036592
AA Change: F145L

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043802
Gene: ENSMUSG00000040163
AA Change: F145L

DomainStartEndE-ValueType
Pfam:DUF4640 18 301 2.7e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111622
AA Change: F145L

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107249
Gene: ENSMUSG00000040163
AA Change: F145L

DomainStartEndE-ValueType
Pfam:DUF4640 18 300 1.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111623
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203730
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Il22ra2 A T 10: 19,626,652 D73V possibly damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Olfr205 A C 16: 59,328,880 S210A probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ppp1r13l A T 7: 19,370,053 H153L probably benign Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Txndc2 A G 17: 65,638,084 I366T possibly damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in 1700034J05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:1700034J05Rik APN 6 146953340 missense probably damaging 1.00
IGL01725:1700034J05Rik APN 6 146952269 missense probably damaging 0.97
IGL01860:1700034J05Rik APN 6 146952416 missense possibly damaging 0.77
IGL01991:1700034J05Rik APN 6 146953110 missense probably benign 0.32
IGL02375:1700034J05Rik APN 6 146953315 missense possibly damaging 0.92
R0254:1700034J05Rik UTSW 6 146952404 missense probably benign 0.00
R0361:1700034J05Rik UTSW 6 146952371 missense possibly damaging 0.94
R0835:1700034J05Rik UTSW 6 146953538 intron probably benign
R1101:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1428:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1487:1700034J05Rik UTSW 6 146953379 missense probably benign 0.16
R1887:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1988:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R1989:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R6122:1700034J05Rik UTSW 6 146952252 makesense probably null
R6578:1700034J05Rik UTSW 6 146953314 nonsense probably null
R7029:1700034J05Rik UTSW 6 146952343 missense probably benign 0.00
R7585:1700034J05Rik UTSW 6 146953353 missense probably benign 0.00
R7842:1700034J05Rik UTSW 6 146953536 missense unknown
R7925:1700034J05Rik UTSW 6 146953536 missense unknown
X0066:1700034J05Rik UTSW 6 146953540 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCAGTAACCTTGGAGGATCCTC -3'
(R):5'- AGCATGACCCAGAGCAGTTC -3'

Sequencing Primer
(F):5'- GTAACCTTGGAGGATCCTCTAGCAC -3'
(R):5'- GCAGTTCAGCAAGCTAAGC -3'
Posted On2015-05-15