Incidental Mutation 'R4063:Irag1'
ID 315963
Institutional Source Beutler Lab
Gene Symbol Irag1
Ensembl Gene ENSMUSG00000005611
Gene Name inositol 1,4,5-triphosphate receptor associated 1
Synonyms Ris1, Mrvi1
MMRRC Submission 041619-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R4063 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 110467473-110581668 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 110522984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 359 (A359D)
Ref Sequence ENSEMBL: ENSMUSP00000114578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005751] [ENSMUST00000125758] [ENSMUST00000127935] [ENSMUST00000154466]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005751
AA Change: A294D

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005751
Gene: ENSMUSG00000005611
AA Change: A294D

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
low complexity region 138 160 N/A INTRINSIC
Pfam:MRVI1 265 856 1.8e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125758
AA Change: A359D

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114578
Gene: ENSMUSG00000005611
AA Change: A359D

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
Pfam:MRVI1 336 921 1.5e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127935
AA Change: A153D

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120045
Gene: ENSMUSG00000005611
AA Change: A153D

DomainStartEndE-ValueType
Pfam:MRVI1 124 715 7.9e-228 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149923
Predicted Effect probably benign
Transcript: ENSMUST00000154466
SMART Domains Protein: ENSMUSP00000120765
Gene: ENSMUSG00000005611

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene is a putative tumor suppressor gene that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein participates in signaling by nitric oxide (NO) to inhibit intracellular calcium release and platelet aggregation in cardiovascular tissue. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show lower blood pressure, a slightly reduced heart rate, and failure of cGMP-mediated relaxation of receptor-triggered smooth muscle contraction; 50% of mice die prematurely with an enlarged stomach, a dilated cecum, pyloric stenosis and impaired GI motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,854,606 (GRCm39) F145L probably benign Het
Abcc9 T C 6: 142,551,645 (GRCm39) D1221G possibly damaging Het
Adamtsl4 T C 3: 95,584,864 (GRCm39) K935E probably benign Het
Ago4 A T 4: 126,409,655 (GRCm39) probably benign Het
Arhgef28 T C 13: 98,130,575 (GRCm39) D421G probably benign Het
Armh4 T A 14: 50,011,444 (GRCm39) M88L probably benign Het
Atl2 T C 17: 80,157,588 (GRCm39) *413W probably null Het
B4galt7 C A 13: 55,756,152 (GRCm39) probably null Het
Bltp3b A G 10: 89,651,917 (GRCm39) N247S probably benign Het
C8g A T 2: 25,389,425 (GRCm39) S147T probably damaging Het
Clstn3 A T 6: 124,426,792 (GRCm39) Y510N possibly damaging Het
Cnot2 A G 10: 116,373,301 (GRCm39) V34A possibly damaging Het
Cyb5d2 A T 11: 72,686,606 (GRCm39) probably benign Het
Dnah5 T C 15: 28,421,144 (GRCm39) I3827T probably damaging Het
Dnah7a G T 1: 53,464,376 (GRCm39) Q3672K probably benign Het
Dock1 A T 7: 134,717,021 (GRCm39) Y1219F possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fat1 A T 8: 45,478,518 (GRCm39) E2521D probably benign Het
Gm10719 G T 9: 3,019,043 (GRCm39) W96L probably damaging Het
H2-M2 G A 17: 37,792,399 (GRCm39) H291Y probably damaging Het
Hmgcl T C 4: 135,686,035 (GRCm39) Y167H probably damaging Het
Il22ra2 A T 10: 19,502,400 (GRCm39) D73V possibly damaging Het
Incenp A T 19: 9,861,142 (GRCm39) M480K unknown Het
Kdm6a A G X: 18,117,114 (GRCm39) T266A probably benign Het
Lipf A G 19: 33,942,965 (GRCm39) N91S probably benign Het
M1ap A T 6: 82,980,756 (GRCm39) N214I probably damaging Het
Mast3 A G 8: 71,233,838 (GRCm39) V969A probably damaging Het
Mdga1 A G 17: 30,057,005 (GRCm39) C826R probably damaging Het
Msx1 C A 5: 37,981,365 (GRCm39) A105S probably benign Het
Or5ac23 A C 16: 59,149,243 (GRCm39) S210A probably benign Het
Otogl A T 10: 107,626,510 (GRCm39) D1451E probably benign Het
Otop2 G A 11: 115,220,201 (GRCm39) G347D probably damaging Het
Ppp1r13l A T 7: 19,103,978 (GRCm39) H153L probably benign Het
Pramel21 A G 4: 143,342,559 (GRCm39) D222G possibly damaging Het
Pramel29 T C 4: 143,935,265 (GRCm39) K161E possibly damaging Het
Proz A G 8: 13,114,621 (GRCm39) Y85C probably damaging Het
Prss50 A G 9: 110,687,480 (GRCm39) D141G probably benign Het
Rad54l2 T A 9: 106,597,613 (GRCm39) Q131L probably benign Het
Sdha A G 13: 74,472,077 (GRCm39) probably benign Het
Sema3d T A 5: 12,635,091 (GRCm39) I719N probably benign Het
Slc18b1 A T 10: 23,681,879 (GRCm39) I148L probably benign Het
Tacc2 G T 7: 130,330,852 (GRCm39) D2086Y probably damaging Het
Tchh T C 3: 93,354,298 (GRCm39) L1246P unknown Het
Tmprss11d T C 5: 86,457,177 (GRCm39) I161V probably benign Het
Trpc3 T C 3: 36,725,172 (GRCm39) D268G probably damaging Het
Trpm8 G A 1: 88,289,727 (GRCm39) R895H probably damaging Het
Txndc2 A G 17: 65,945,079 (GRCm39) I366T possibly damaging Het
Ugt2a3 T C 5: 87,484,725 (GRCm39) I100V probably benign Het
Upp1 C A 11: 9,081,709 (GRCm39) P82Q probably damaging Het
Vim A G 2: 13,584,827 (GRCm39) probably null Het
Vmn2r12 A T 5: 109,240,058 (GRCm39) N168K possibly damaging Het
Zdhhc14 G T 17: 5,802,983 (GRCm39) C362F probably damaging Het
Zfp292 A G 4: 34,810,863 (GRCm39) V727A probably damaging Het
Zswim5 G A 4: 116,735,177 (GRCm39) G174D unknown Het
Other mutations in Irag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Irag1 APN 7 110,545,174 (GRCm39) missense possibly damaging 0.64
IGL01384:Irag1 APN 7 110,525,708 (GRCm39) missense possibly damaging 0.89
IGL01474:Irag1 APN 7 110,470,640 (GRCm39) missense possibly damaging 0.65
IGL02081:Irag1 APN 7 110,523,281 (GRCm39) critical splice acceptor site probably null
IGL02193:Irag1 APN 7 110,498,162 (GRCm39) missense probably damaging 1.00
IGL02537:Irag1 APN 7 110,470,680 (GRCm39) nonsense probably null
IGL03084:Irag1 APN 7 110,485,036 (GRCm39) splice site probably benign
IGL03264:Irag1 APN 7 110,525,553 (GRCm39) missense probably benign 0.00
hurricane UTSW 7 110,523,170 (GRCm39) missense probably benign 0.09
R0346:Irag1 UTSW 7 110,498,183 (GRCm39) missense probably damaging 1.00
R0401:Irag1 UTSW 7 110,476,104 (GRCm39) missense probably benign 0.09
R0731:Irag1 UTSW 7 110,476,107 (GRCm39) missense probably benign 0.00
R1168:Irag1 UTSW 7 110,495,138 (GRCm39) missense probably damaging 1.00
R1342:Irag1 UTSW 7 110,487,252 (GRCm39) missense probably benign 0.07
R1887:Irag1 UTSW 7 110,523,740 (GRCm39) critical splice donor site probably null
R2183:Irag1 UTSW 7 110,498,189 (GRCm39) missense probably damaging 1.00
R3417:Irag1 UTSW 7 110,476,161 (GRCm39) missense possibly damaging 0.90
R3736:Irag1 UTSW 7 110,523,170 (GRCm39) missense probably benign 0.09
R4436:Irag1 UTSW 7 110,476,124 (GRCm39) missense probably damaging 1.00
R4523:Irag1 UTSW 7 110,523,048 (GRCm39) missense probably benign 0.02
R4948:Irag1 UTSW 7 110,487,236 (GRCm39) missense probably damaging 1.00
R5070:Irag1 UTSW 7 110,524,519 (GRCm39) missense probably benign
R5085:Irag1 UTSW 7 110,470,700 (GRCm39) missense probably damaging 1.00
R5605:Irag1 UTSW 7 110,545,209 (GRCm39) missense possibly damaging 0.85
R6194:Irag1 UTSW 7 110,498,901 (GRCm39) missense probably damaging 1.00
R6218:Irag1 UTSW 7 110,476,112 (GRCm39) missense probably benign 0.00
R6273:Irag1 UTSW 7 110,470,790 (GRCm39) missense probably benign 0.01
R6608:Irag1 UTSW 7 110,487,758 (GRCm39) missense probably damaging 1.00
R6754:Irag1 UTSW 7 110,528,719 (GRCm39) missense probably damaging 1.00
R6835:Irag1 UTSW 7 110,520,541 (GRCm39) missense probably damaging 1.00
R7064:Irag1 UTSW 7 110,495,061 (GRCm39) missense probably damaging 1.00
R7304:Irag1 UTSW 7 110,498,931 (GRCm39) missense possibly damaging 0.77
R7412:Irag1 UTSW 7 110,522,963 (GRCm39) missense probably benign 0.06
R7420:Irag1 UTSW 7 110,470,680 (GRCm39) nonsense probably null
R7857:Irag1 UTSW 7 110,522,742 (GRCm39) nonsense probably null
R8078:Irag1 UTSW 7 110,498,942 (GRCm39) missense probably damaging 1.00
R8139:Irag1 UTSW 7 110,498,879 (GRCm39) critical splice donor site probably null
R8280:Irag1 UTSW 7 110,522,828 (GRCm39) missense possibly damaging 0.82
R8733:Irag1 UTSW 7 110,477,425 (GRCm39) missense probably benign 0.02
R8946:Irag1 UTSW 7 110,477,347 (GRCm39) critical splice donor site probably null
R9150:Irag1 UTSW 7 110,498,205 (GRCm39) missense probably benign 0.12
R9321:Irag1 UTSW 7 110,524,534 (GRCm39) missense probably benign 0.03
R9373:Irag1 UTSW 7 110,545,038 (GRCm39) critical splice donor site probably null
R9445:Irag1 UTSW 7 110,545,161 (GRCm39) missense possibly damaging 0.71
R9482:Irag1 UTSW 7 110,545,259 (GRCm39) missense probably benign 0.03
R9715:Irag1 UTSW 7 110,470,640 (GRCm39) missense possibly damaging 0.65
X0065:Irag1 UTSW 7 110,523,251 (GRCm39) missense probably benign 0.31
Z1176:Irag1 UTSW 7 110,523,206 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCTGGAAGTCTTTGAGCCCAG -3'
(R):5'- TTGATCCCCTTCAGCACGTG -3'

Sequencing Primer
(F):5'- TGCCTGGAAACCGCTTC -3'
(R):5'- TTCAGCACGTGGAGGCC -3'
Posted On 2015-05-15