Incidental Mutation 'R0390:Tjp1'
ID 31597
Institutional Source Beutler Lab
Gene Symbol Tjp1
Ensembl Gene ENSMUSG00000030516
Gene Name tight junction protein 1
Synonyms ZO1, ZO-1
MMRRC Submission 038596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0390 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 65296165-65527781 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65314990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 811 (D811G)
Ref Sequence ENSEMBL: ENSMUSP00000146149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032729] [ENSMUST00000102592] [ENSMUST00000206612]
AlphaFold P39447
Predicted Effect probably damaging
Transcript: ENSMUST00000032729
AA Change: D811G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032729
Gene: ENSMUSG00000030516
AA Change: D811G

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 1157 1176 N/A INTRINSIC
low complexity region 1246 1257 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1339 1365 N/A INTRINSIC
low complexity region 1389 1400 N/A INTRINSIC
ZU5 1549 1654 1.1e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102592
AA Change: D811G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099652
Gene: ENSMUSG00000030516
AA Change: D811G

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 939 955 N/A INTRINSIC
low complexity region 1237 1256 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1388 1399 N/A INTRINSIC
low complexity region 1419 1445 N/A INTRINSIC
low complexity region 1469 1480 N/A INTRINSIC
ZU5 1629 1735 1.84e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206612
AA Change: D811G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality and growth retardation, failure of embryo turning and chorioallantoic fusion, defective yolk sac angiogenesis, and increased apoptosis in the notochord, neural tube, somite and allantois. Homozygotes for a reporter allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Tjp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tjp1 APN 7 65301219 missense probably benign
IGL00848:Tjp1 APN 7 65303194 missense probably benign 0.00
IGL01363:Tjp1 APN 7 65302965 missense possibly damaging 0.94
IGL01526:Tjp1 APN 7 65322658 missense probably damaging 1.00
IGL01607:Tjp1 APN 7 65336178 missense possibly damaging 0.94
IGL02223:Tjp1 APN 7 65322601 missense probably damaging 1.00
IGL02341:Tjp1 APN 7 65312634 missense probably damaging 1.00
IGL02347:Tjp1 APN 7 65301064 critical splice donor site probably null
IGL02452:Tjp1 APN 7 65312655 missense probably damaging 1.00
IGL02512:Tjp1 APN 7 65343667 missense probably damaging 1.00
IGL02552:Tjp1 APN 7 65299782 nonsense probably null
IGL02707:Tjp1 APN 7 65329683 nonsense probably null
IGL02707:Tjp1 APN 7 65329682 missense possibly damaging 0.85
IGL02939:Tjp1 APN 7 65314890 missense probably damaging 1.00
IGL03139:Tjp1 APN 7 65340434 splice site probably benign
IGL03273:Tjp1 APN 7 65299799 missense probably damaging 1.00
IGL03391:Tjp1 APN 7 65314969 missense probably damaging 1.00
PIT4453001:Tjp1 UTSW 7 65343614 critical splice donor site probably null
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0519:Tjp1 UTSW 7 65302921 missense probably benign
R0653:Tjp1 UTSW 7 65314755 missense probably damaging 1.00
R1163:Tjp1 UTSW 7 65323054 missense probably damaging 1.00
R1544:Tjp1 UTSW 7 65302921 missense probably benign
R1634:Tjp1 UTSW 7 65302952 missense possibly damaging 0.94
R1767:Tjp1 UTSW 7 65312553 critical splice donor site probably null
R1771:Tjp1 UTSW 7 65313005 missense probably benign 0.45
R1794:Tjp1 UTSW 7 65323129 missense probably damaging 1.00
R1874:Tjp1 UTSW 7 65319253 missense probably damaging 1.00
R1971:Tjp1 UTSW 7 65324078 missense probably damaging 1.00
R1981:Tjp1 UTSW 7 65312855 missense probably damaging 0.99
R2086:Tjp1 UTSW 7 65312921 missense probably damaging 1.00
R2310:Tjp1 UTSW 7 65329742 missense possibly damaging 0.90
R2942:Tjp1 UTSW 7 65318006 missense probably damaging 1.00
R3974:Tjp1 UTSW 7 65297639 nonsense probably null
R4295:Tjp1 UTSW 7 65323150 missense probably damaging 1.00
R4296:Tjp1 UTSW 7 65318489 missense probably damaging 1.00
R4567:Tjp1 UTSW 7 65306501 missense probably damaging 1.00
R4574:Tjp1 UTSW 7 65322605 missense probably damaging 1.00
R4910:Tjp1 UTSW 7 65343727 missense probably damaging 1.00
R4958:Tjp1 UTSW 7 65336102 nonsense probably null
R5267:Tjp1 UTSW 7 65323049 missense probably damaging 1.00
R5371:Tjp1 UTSW 7 65313311 nonsense probably null
R5422:Tjp1 UTSW 7 65302967 missense probably damaging 0.99
R5514:Tjp1 UTSW 7 65354861 missense probably damaging 1.00
R5652:Tjp1 UTSW 7 65312443 splice site probably null
R5693:Tjp1 UTSW 7 65342663 missense possibly damaging 0.96
R5933:Tjp1 UTSW 7 65302852 missense probably benign 0.29
R6043:Tjp1 UTSW 7 65324089 missense probably damaging 1.00
R6416:Tjp1 UTSW 7 65313205 missense possibly damaging 0.76
R6491:Tjp1 UTSW 7 65337117 missense possibly damaging 0.62
R6525:Tjp1 UTSW 7 65343651 missense probably damaging 1.00
R6658:Tjp1 UTSW 7 65301077 missense possibly damaging 0.82
R6917:Tjp1 UTSW 7 65299688 missense probably damaging 0.99
R6960:Tjp1 UTSW 7 65303015 missense possibly damaging 0.59
R7235:Tjp1 UTSW 7 65318573 missense probably benign 0.16
R7274:Tjp1 UTSW 7 65527652 missense possibly damaging 0.86
R7471:Tjp1 UTSW 7 65314690 missense probably damaging 0.99
R7475:Tjp1 UTSW 7 65322339 missense probably damaging 1.00
R7479:Tjp1 UTSW 7 65301180 missense probably damaging 0.98
R8035:Tjp1 UTSW 7 65342702 missense probably benign 0.34
R8195:Tjp1 UTSW 7 65343722 missense probably damaging 1.00
R8276:Tjp1 UTSW 7 65343796 intron probably benign
R8817:Tjp1 UTSW 7 65303062 missense probably benign 0.41
R8869:Tjp1 UTSW 7 65336638 missense probably damaging 1.00
R9043:Tjp1 UTSW 7 65312931 missense probably benign 0.03
R9079:Tjp1 UTSW 7 65301218 missense possibly damaging 0.77
R9081:Tjp1 UTSW 7 65314262 missense possibly damaging 0.71
R9095:Tjp1 UTSW 7 65302997 missense possibly damaging 0.82
R9145:Tjp1 UTSW 7 65302816 missense probably benign 0.00
R9215:Tjp1 UTSW 7 65312847 missense probably benign
X0022:Tjp1 UTSW 7 65302841 missense possibly damaging 0.75
X0027:Tjp1 UTSW 7 65314759 missense probably benign 0.18
Z1177:Tjp1 UTSW 7 65343732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGAATGCTTGCTGCTTACCTG -3'
(R):5'- AGCCTCTGTTTGATTCATCCAAGCC -3'

Sequencing Primer
(F):5'- TCTCTTACAGGCTCAGAGGAC -3'
(R):5'- ATCTCAGGGGATGCTATGTATATC -3'
Posted On 2013-04-24