Mutagenetix > Incidental Mutation

Incidental Mutation 'R4063:Incenp'

315992

Institutional Source

Beutler Lab

Gene Symbol

Incenp

Ensembl Gene

ENSMUSG00000024660

Gene Name

inner centromere protein

Synonyms

2700067E22Rik

MMRRC Submission

041619-MU

Accession Numbers

Genbank: NM_016692

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4063 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9872297-9899533 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9883778 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 480 (M480K)

Ref Sequence

ENSEMBL: ENSMUSP00000025562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025562]

AlphaFold

Q9WU62

Predicted Effect

unknown
Transcript: ENSMUST00000025562
AA Change: M480K

SMART Domains

Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660
AA Change: M480K

Domain	Start	End	E-Value	Type
Pfam:INCENP_N	6	41	1.9e-18	PFAM
low complexity region	83	94	N/A	INTRINSIC
low complexity region	123	145	N/A	INTRINSIC
low complexity region	308	314	N/A	INTRINSIC
low complexity region	350	367	N/A	INTRINSIC
low complexity region	434	447	N/A	INTRINSIC
low complexity region	517	553	N/A	INTRINSIC
low complexity region	557	573	N/A	INTRINSIC
SCOP:d1f5na1	631	739	7e-3	SMART
Pfam:INCENP_ARK-bind	789	846	1.5e-22	PFAM

Meta Mutation Damage Score

0.1286

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	A	T	6: 146,953,108	F145L	probably benign	Het
3632451O06Rik	T	A	14: 49,773,987	M88L	probably benign	Het
Abcc9	T	C	6: 142,605,919	D1221G	possibly damaging	Het
Adamtsl4	T	C	3: 95,677,554	K935E	probably benign	Het
Ago4	A	T	4: 126,515,862		probably benign	Het
Arhgef28	T	C	13: 97,994,067	D421G	probably benign	Het
Atl2	T	C	17: 79,850,159	*413W	probably null	Het
B4galt7	C	A	13: 55,608,339		probably null	Het
C87977	T	C	4: 144,208,695	K161E	possibly damaging	Het
C8g	A	T	2: 25,499,413	S147T	probably damaging	Het
Clstn3	A	T	6: 124,449,833	Y510N	possibly damaging	Het
Cnot2	A	G	10: 116,537,396	V34A	possibly damaging	Het
Cyb5d2	A	T	11: 72,795,780		probably benign	Het
Dnah5	T	C	15: 28,420,998	I3827T	probably damaging	Het
Dnah7a	G	T	1: 53,425,217	Q3672K	probably benign	Het
Dock1	A	T	7: 135,115,292	Y1219F	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Gm10719	G	T	9: 3,019,043	W96L	probably damaging	Het
Gm13083	A	G	4: 143,615,989	D222G	possibly damaging	Het
H2-M2	G	A	17: 37,481,508	H291Y	probably damaging	Het
Hmgcl	T	C	4: 135,958,724	Y167H	probably damaging	Het
Il22ra2	A	T	10: 19,626,652	D73V	possibly damaging	Het
Kdm6a	A	G	X: 18,250,875	T266A	probably benign	Het
Lipf	A	G	19: 33,965,565	N91S	probably benign	Het
M1ap	A	T	6: 83,003,775	N214I	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Mdga1	A	G	17: 29,838,031	C826R	probably damaging	Het
Mrvi1	G	T	7: 110,923,777	A359D	probably benign	Het
Msx1	C	A	5: 37,824,021	A105S	probably benign	Het
Olfr205	A	C	16: 59,328,880	S210A	probably benign	Het
Otogl	A	T	10: 107,790,649	D1451E	probably benign	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Ppp1r13l	A	T	7: 19,370,053	H153L	probably benign	Het
Proz	A	G	8: 13,064,621	Y85C	probably damaging	Het
Prss50	A	G	9: 110,858,412	D141G	probably benign	Het
Rad54l2	T	A	9: 106,720,414	Q131L	probably benign	Het
Sdha	A	G	13: 74,323,958		probably benign	Het
Sema3d	T	A	5: 12,585,124	I719N	probably benign	Het
Slc18b1	A	T	10: 23,805,981	I148L	probably benign	Het
Tacc2	G	T	7: 130,729,122	D2086Y	probably damaging	Het
Tchh	T	C	3: 93,446,991	L1246P	unknown	Het
Tmprss11d	T	C	5: 86,309,318	I161V	probably benign	Het
Trpc3	T	C	3: 36,671,023	D268G	probably damaging	Het
Trpm8	G	A	1: 88,362,005	R895H	probably damaging	Het
Txndc2	A	G	17: 65,638,084	I366T	possibly damaging	Het
Ugt2a3	T	C	5: 87,336,866	I100V	probably benign	Het
Uhrf1bp1l	A	G	10: 89,816,055	N247S	probably benign	Het
Upp1	C	A	11: 9,131,709	P82Q	probably damaging	Het
Vim	A	G	2: 13,580,016		probably null	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het
Zdhhc14	G	T	17: 5,752,708	C362F	probably damaging	Het
Zfp292	A	G	4: 34,810,863	V727A	probably damaging	Het
Zswim5	G	A	4: 116,877,980	G174D	unknown	Het

Other mutations in Incenp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01324:Incenp	APN	19	9883728	missense	unknown
IGL01717:Incenp	APN	19	9893265	splice site	probably benign
IGL02485:Incenp	APN	19	9893368	missense	unknown
IGL02488:Incenp	APN	19	9893407	missense	unknown
B5639:Incenp	UTSW	19	9893818	missense	unknown
R0060:Incenp	UTSW	19	9885459	splice site	probably benign
R0164:Incenp	UTSW	19	9894879	missense	probably benign	0.23
R0164:Incenp	UTSW	19	9894879	missense	probably benign	0.23
R0242:Incenp	UTSW	19	9893750	missense	unknown
R0242:Incenp	UTSW	19	9893750	missense	unknown
R0284:Incenp	UTSW	19	9893993	missense	unknown
R1264:Incenp	UTSW	19	9884015	missense	unknown
R1432:Incenp	UTSW	19	9885526	missense	unknown
R1679:Incenp	UTSW	19	9895414	missense	unknown
R1827:Incenp	UTSW	19	9872729	missense	possibly damaging	0.94
R1970:Incenp	UTSW	19	9885487	missense	unknown
R3082:Incenp	UTSW	19	9883779	missense	unknown
R3083:Incenp	UTSW	19	9883779	missense	unknown
R4062:Incenp	UTSW	19	9883778	missense	unknown
R4534:Incenp	UTSW	19	9883939	missense	unknown
R4535:Incenp	UTSW	19	9883939	missense	unknown
R4536:Incenp	UTSW	19	9883939	missense	unknown
R4709:Incenp	UTSW	19	9876600	missense	unknown
R4785:Incenp	UTSW	19	9877690	missense	unknown
R4785:Incenp	UTSW	19	9877691	missense	unknown
R5179:Incenp	UTSW	19	9894909	missense	unknown
R5282:Incenp	UTSW	19	9878406	missense	unknown
R5400:Incenp	UTSW	19	9877675	critical splice donor site	probably null
R5502:Incenp	UTSW	19	9893364	missense	unknown
R5608:Incenp	UTSW	19	9893868	small insertion	probably benign
R6033:Incenp	UTSW	19	9872697	missense	probably damaging	0.99
R6033:Incenp	UTSW	19	9872697	missense	probably damaging	0.99
R6807:Incenp	UTSW	19	9877756	missense	unknown
R6885:Incenp	UTSW	19	9875132	missense	unknown
R6959:Incenp	UTSW	19	9876770	missense	unknown
R7033:Incenp	UTSW	19	9893372	missense	unknown
R8258:Incenp	UTSW	19	9893629	missense	unknown
R8258:Incenp	UTSW	19	9893641	missense	unknown
R8259:Incenp	UTSW	19	9893629	missense	unknown
R8259:Incenp	UTSW	19	9893641	missense	unknown
R8293:Incenp	UTSW	19	9875133	nonsense	probably null
R9005:Incenp	UTSW	19	9877724	nonsense	probably null
R9491:Incenp	UTSW	19	9876777	missense	unknown
Z1176:Incenp	UTSW	19	9877687	missense	unknown
Z1177:Incenp	UTSW	19	9899364	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTGAACTCGATCGCCCATC -3'
(R):5'- AAGATGAAGAACTGCAGCCC -3'

Sequencing Primer
(F):5'- GATCGCCCATCAGTGTCTGAC -3'
(R):5'- CTGCCAGAATAAGACCCCTTC -3'

Posted On

2015-05-15